ID: 902659710

View in Genome Browser
Species Human (GRCh38)
Location 1:17892582-17892604
Sequence GATTTTCACTACAAGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902659710_902659715 25 Left 902659710 1:17892582-17892604 CCTCTTTTCTTGTAGTGAAAATC No data
Right 902659715 1:17892630-17892652 TCTTCTTCCCCAAGGAGGCTGGG No data
902659710_902659716 28 Left 902659710 1:17892582-17892604 CCTCTTTTCTTGTAGTGAAAATC No data
Right 902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG No data
902659710_902659712 20 Left 902659710 1:17892582-17892604 CCTCTTTTCTTGTAGTGAAAATC No data
Right 902659712 1:17892625-17892647 CAGCCTCTTCTTCCCCAAGGAGG No data
902659710_902659714 24 Left 902659710 1:17892582-17892604 CCTCTTTTCTTGTAGTGAAAATC No data
Right 902659714 1:17892629-17892651 CTCTTCTTCCCCAAGGAGGCTGG No data
902659710_902659711 17 Left 902659710 1:17892582-17892604 CCTCTTTTCTTGTAGTGAAAATC No data
Right 902659711 1:17892622-17892644 TTTCAGCCTCTTCTTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902659710 Original CRISPR GATTTTCACTACAAGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr