ID: 902659716

View in Genome Browser
Species Human (GRCh38)
Location 1:17892633-17892655
Sequence TCTTCCCCAAGGAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902659710_902659716 28 Left 902659710 1:17892582-17892604 CCTCTTTTCTTGTAGTGAAAATC No data
Right 902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902659716 Original CRISPR TCTTCCCCAAGGAGGCTGGG TGG Intergenic
No off target data available for this crispr