ID: 902660471

View in Genome Browser
Species Human (GRCh38)
Location 1:17897303-17897325
Sequence TTTTGTCATCTAACTTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902660471_902660476 7 Left 902660471 1:17897303-17897325 CCTAGAGAAGTTAGATGACAAAA No data
Right 902660476 1:17897333-17897355 CCAACCATGTAGCCAGTTGGTGG No data
902660471_902660474 4 Left 902660471 1:17897303-17897325 CCTAGAGAAGTTAGATGACAAAA No data
Right 902660474 1:17897330-17897352 TGGCCAACCATGTAGCCAGTTGG No data
902660471_902660479 17 Left 902660471 1:17897303-17897325 CCTAGAGAAGTTAGATGACAAAA No data
Right 902660479 1:17897343-17897365 AGCCAGTTGGTGGTGATGCTGGG No data
902660471_902660478 16 Left 902660471 1:17897303-17897325 CCTAGAGAAGTTAGATGACAAAA No data
Right 902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902660471 Original CRISPR TTTTGTCATCTAACTTCTCT AGG (reversed) Intergenic
No off target data available for this crispr