ID: 902660473

View in Genome Browser
Species Human (GRCh38)
Location 1:17897327-17897349
Sequence ACTGGCTACATGGTTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902660473_902660478 -8 Left 902660473 1:17897327-17897349 CCTTGGCCAACCATGTAGCCAGT No data
Right 902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG No data
902660473_902660481 21 Left 902660473 1:17897327-17897349 CCTTGGCCAACCATGTAGCCAGT No data
Right 902660481 1:17897371-17897393 AACCTGAGCTTCCTGACTCCTGG No data
902660473_902660479 -7 Left 902660473 1:17897327-17897349 CCTTGGCCAACCATGTAGCCAGT No data
Right 902660479 1:17897343-17897365 AGCCAGTTGGTGGTGATGCTGGG No data
902660473_902660483 26 Left 902660473 1:17897327-17897349 CCTTGGCCAACCATGTAGCCAGT No data
Right 902660483 1:17897376-17897398 GAGCTTCCTGACTCCTGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902660473 Original CRISPR ACTGGCTACATGGTTGGCCA AGG (reversed) Intergenic
No off target data available for this crispr