ID: 902660478

View in Genome Browser
Species Human (GRCh38)
Location 1:17897342-17897364
Sequence TAGCCAGTTGGTGGTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902660471_902660478 16 Left 902660471 1:17897303-17897325 CCTAGAGAAGTTAGATGACAAAA No data
Right 902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG No data
902660473_902660478 -8 Left 902660473 1:17897327-17897349 CCTTGGCCAACCATGTAGCCAGT No data
Right 902660478 1:17897342-17897364 TAGCCAGTTGGTGGTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902660478 Original CRISPR TAGCCAGTTGGTGGTGATGC TGG Intergenic
No off target data available for this crispr