ID: 902661735

View in Genome Browser
Species Human (GRCh38)
Location 1:17909063-17909085
Sequence CTGGTCATGTGACCTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902661735_902661739 -6 Left 902661735 1:17909063-17909085 CCAGACCCAGGTCACATGACCAG No data
Right 902661739 1:17909080-17909102 GACCAGCCCTGACCCTGGAGAGG No data
902661735_902661740 -5 Left 902661735 1:17909063-17909085 CCAGACCCAGGTCACATGACCAG No data
Right 902661740 1:17909081-17909103 ACCAGCCCTGACCCTGGAGAGGG No data
902661735_902661742 -4 Left 902661735 1:17909063-17909085 CCAGACCCAGGTCACATGACCAG No data
Right 902661742 1:17909082-17909104 CCAGCCCTGACCCTGGAGAGGGG No data
902661735_902661745 1 Left 902661735 1:17909063-17909085 CCAGACCCAGGTCACATGACCAG No data
Right 902661745 1:17909087-17909109 CCTGACCCTGGAGAGGGGACTGG No data
902661735_902661746 2 Left 902661735 1:17909063-17909085 CCAGACCCAGGTCACATGACCAG No data
Right 902661746 1:17909088-17909110 CTGACCCTGGAGAGGGGACTGGG No data
902661735_902661749 24 Left 902661735 1:17909063-17909085 CCAGACCCAGGTCACATGACCAG No data
Right 902661749 1:17909110-17909132 GCCACACTCAGCCATGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902661735 Original CRISPR CTGGTCATGTGACCTGGGTC TGG (reversed) Intergenic
No off target data available for this crispr