ID: 902662215

View in Genome Browser
Species Human (GRCh38)
Location 1:17913122-17913144
Sequence TGAAAGCTAGATCTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902662206_902662215 28 Left 902662206 1:17913071-17913093 CCTCACTCAGATTCAACTCATAA No data
Right 902662215 1:17913122-17913144 TGAAAGCTAGATCTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902662215 Original CRISPR TGAAAGCTAGATCTGGGGAG GGG Intergenic
No off target data available for this crispr