ID: 902663311

View in Genome Browser
Species Human (GRCh38)
Location 1:17920431-17920453
Sequence ACCCTATGGCTCCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902663311_902663315 -10 Left 902663311 1:17920431-17920453 CCAGCACAGTGGAGCCATAGGGT No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902663311 Original CRISPR ACCCTATGGCTCCACTGTGC TGG (reversed) Intergenic