ID: 902663315

View in Genome Browser
Species Human (GRCh38)
Location 1:17920444-17920466
Sequence GCCATAGGGTAGAAGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902663302_902663315 18 Left 902663302 1:17920403-17920425 CCCCCACTGTAGGACGTTCTGGG No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663306_902663315 15 Left 902663306 1:17920406-17920428 CCACTGTAGGACGTTCTGGGTTG No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663300_902663315 23 Left 902663300 1:17920398-17920420 CCTGTCCCCCACTGTAGGACGTT No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663299_902663315 26 Left 902663299 1:17920395-17920417 CCTCCTGTCCCCCACTGTAGGAC No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663298_902663315 27 Left 902663298 1:17920394-17920416 CCCTCCTGTCCCCCACTGTAGGA No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663305_902663315 16 Left 902663305 1:17920405-17920427 CCCACTGTAGGACGTTCTGGGTT No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663311_902663315 -10 Left 902663311 1:17920431-17920453 CCAGCACAGTGGAGCCATAGGGT No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663296_902663315 28 Left 902663296 1:17920393-17920415 CCCCTCCTGTCCCCCACTGTAGG No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data
902663304_902663315 17 Left 902663304 1:17920404-17920426 CCCCACTGTAGGACGTTCTGGGT No data
Right 902663315 1:17920444-17920466 GCCATAGGGTAGAAGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902663315 Original CRISPR GCCATAGGGTAGAAGGGAAA GGG Intergenic