ID: 902663719

View in Genome Browser
Species Human (GRCh38)
Location 1:17923018-17923040
Sequence CAAGTTCTCCAGATCTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902663717_902663719 6 Left 902663717 1:17922989-17923011 CCATGTGGGCAAGACCAGTGTTT No data
Right 902663719 1:17923018-17923040 CAAGTTCTCCAGATCTCTAGAGG No data
902663718_902663719 -8 Left 902663718 1:17923003-17923025 CCAGTGTTTCTAACACAAGTTCT No data
Right 902663719 1:17923018-17923040 CAAGTTCTCCAGATCTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902663719 Original CRISPR CAAGTTCTCCAGATCTCTAG AGG Intergenic
No off target data available for this crispr