ID: 902664040

View in Genome Browser
Species Human (GRCh38)
Location 1:17925068-17925090
Sequence CATGGAAACAAAGACCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902664040_902664042 -9 Left 902664040 1:17925068-17925090 CCCTCTGGGTCTTTGTTTCCATG No data
Right 902664042 1:17925082-17925104 GTTTCCATGTTTGTAGAAGAAGG No data
902664040_902664045 16 Left 902664040 1:17925068-17925090 CCCTCTGGGTCTTTGTTTCCATG No data
Right 902664045 1:17925107-17925129 CTCAAGGTAGATGACCTTCGAGG No data
902664040_902664044 0 Left 902664040 1:17925068-17925090 CCCTCTGGGTCTTTGTTTCCATG No data
Right 902664044 1:17925091-17925113 TTTGTAGAAGAAGGAACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902664040 Original CRISPR CATGGAAACAAAGACCCAGA GGG (reversed) Intergenic
No off target data available for this crispr