ID: 902664790

View in Genome Browser
Species Human (GRCh38)
Location 1:17929953-17929975
Sequence ACCCCTCCAGGGTGTCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902664790_902664797 6 Left 902664790 1:17929953-17929975 CCATCATGACACCCTGGAGGGGT No data
Right 902664797 1:17929982-17930004 GATGGCAGTAGGTGAGCACGAGG No data
902664790_902664796 -5 Left 902664790 1:17929953-17929975 CCATCATGACACCCTGGAGGGGT No data
Right 902664796 1:17929971-17929993 GGGGTGGTGTGGATGGCAGTAGG No data
902664790_902664798 13 Left 902664790 1:17929953-17929975 CCATCATGACACCCTGGAGGGGT No data
Right 902664798 1:17929989-17930011 GTAGGTGAGCACGAGGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902664790 Original CRISPR ACCCCTCCAGGGTGTCATGA TGG (reversed) Intergenic