ID: 902668329

View in Genome Browser
Species Human (GRCh38)
Location 1:17954607-17954629
Sequence ATCCTGAAGGCTCACCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902668329_902668334 1 Left 902668329 1:17954607-17954629 CCTCAAAGGTGAGCCTTCAGGAT No data
Right 902668334 1:17954631-17954653 CTGGGTCCAGAGTGCAGGCCTGG No data
902668329_902668338 22 Left 902668329 1:17954607-17954629 CCTCAAAGGTGAGCCTTCAGGAT No data
Right 902668338 1:17954652-17954674 GGGTGCCCTAAGCCAGCTCCTGG No data
902668329_902668333 -4 Left 902668329 1:17954607-17954629 CCTCAAAGGTGAGCCTTCAGGAT No data
Right 902668333 1:17954626-17954648 GGATGCTGGGTCCAGAGTGCAGG No data
902668329_902668335 2 Left 902668329 1:17954607-17954629 CCTCAAAGGTGAGCCTTCAGGAT No data
Right 902668335 1:17954632-17954654 TGGGTCCAGAGTGCAGGCCTGGG No data
902668329_902668339 26 Left 902668329 1:17954607-17954629 CCTCAAAGGTGAGCCTTCAGGAT No data
Right 902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902668329 Original CRISPR ATCCTGAAGGCTCACCTTTG AGG (reversed) Intergenic