ID: 902668332

View in Genome Browser
Species Human (GRCh38)
Location 1:17954620-17954642
Sequence CTCTGGACCCAGCATCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902668332_902668343 21 Left 902668332 1:17954620-17954642 CCTTCAGGATGCTGGGTCCAGAG No data
Right 902668343 1:17954664-17954686 CCAGCTCCTGGCTGGTGATGTGG No data
902668332_902668346 30 Left 902668332 1:17954620-17954642 CCTTCAGGATGCTGGGTCCAGAG No data
Right 902668346 1:17954673-17954695 GGCTGGTGATGTGGCTTAGGAGG No data
902668332_902668345 27 Left 902668332 1:17954620-17954642 CCTTCAGGATGCTGGGTCCAGAG No data
Right 902668345 1:17954670-17954692 CCTGGCTGGTGATGTGGCTTAGG No data
902668332_902668339 13 Left 902668332 1:17954620-17954642 CCTTCAGGATGCTGGGTCCAGAG No data
Right 902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG No data
902668332_902668338 9 Left 902668332 1:17954620-17954642 CCTTCAGGATGCTGGGTCCAGAG No data
Right 902668338 1:17954652-17954674 GGGTGCCCTAAGCCAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902668332 Original CRISPR CTCTGGACCCAGCATCCTGA AGG (reversed) Intergenic