ID: 902668336

View in Genome Browser
Species Human (GRCh38)
Location 1:17954637-17954659
Sequence GGGCACCCAGGCCTGCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902668336_902668346 13 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668346 1:17954673-17954695 GGCTGGTGATGTGGCTTAGGAGG No data
902668336_902668338 -8 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668338 1:17954652-17954674 GGGTGCCCTAAGCCAGCTCCTGG No data
902668336_902668345 10 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668345 1:17954670-17954692 CCTGGCTGGTGATGTGGCTTAGG No data
902668336_902668343 4 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668343 1:17954664-17954686 CCAGCTCCTGGCTGGTGATGTGG No data
902668336_902668339 -4 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG No data
902668336_902668348 20 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668348 1:17954680-17954702 GATGTGGCTTAGGAGGGTCCAGG No data
902668336_902668347 14 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668347 1:17954674-17954696 GCTGGTGATGTGGCTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902668336 Original CRISPR GGGCACCCAGGCCTGCACTC TGG (reversed) Intergenic