ID: 902668339

View in Genome Browser
Species Human (GRCh38)
Location 1:17954656-17954678
Sequence GCCCTAAGCCAGCTCCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902668336_902668339 -4 Left 902668336 1:17954637-17954659 CCAGAGTGCAGGCCTGGGTGCCC No data
Right 902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG No data
902668332_902668339 13 Left 902668332 1:17954620-17954642 CCTTCAGGATGCTGGGTCCAGAG No data
Right 902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG No data
902668329_902668339 26 Left 902668329 1:17954607-17954629 CCTCAAAGGTGAGCCTTCAGGAT No data
Right 902668339 1:17954656-17954678 GCCCTAAGCCAGCTCCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902668339 Original CRISPR GCCCTAAGCCAGCTCCTGGC TGG Intergenic
No off target data available for this crispr