ID: 902669663

View in Genome Browser
Species Human (GRCh38)
Location 1:17964356-17964378
Sequence TAGCTAAGGCTGCAGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902669663_902669674 20 Left 902669663 1:17964356-17964378 CCCTTGTGCTGCAGCCTTAGCTA No data
Right 902669674 1:17964399-17964421 CCTTCAGGTCCCCAAGGGGAGGG No data
902669663_902669669 14 Left 902669663 1:17964356-17964378 CCCTTGTGCTGCAGCCTTAGCTA No data
Right 902669669 1:17964393-17964415 GTTTTGCCTTCAGGTCCCCAAGG No data
902669663_902669666 5 Left 902669663 1:17964356-17964378 CCCTTGTGCTGCAGCCTTAGCTA No data
Right 902669666 1:17964384-17964406 ACATGCCCAGTTTTGCCTTCAGG No data
902669663_902669671 16 Left 902669663 1:17964356-17964378 CCCTTGTGCTGCAGCCTTAGCTA No data
Right 902669671 1:17964395-17964417 TTTGCCTTCAGGTCCCCAAGGGG No data
902669663_902669672 19 Left 902669663 1:17964356-17964378 CCCTTGTGCTGCAGCCTTAGCTA No data
Right 902669672 1:17964398-17964420 GCCTTCAGGTCCCCAAGGGGAGG No data
902669663_902669670 15 Left 902669663 1:17964356-17964378 CCCTTGTGCTGCAGCCTTAGCTA No data
Right 902669670 1:17964394-17964416 TTTTGCCTTCAGGTCCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902669663 Original CRISPR TAGCTAAGGCTGCAGCACAA GGG (reversed) Intergenic
No off target data available for this crispr