ID: 902671133

View in Genome Browser
Species Human (GRCh38)
Location 1:17974644-17974666
Sequence GGAGGCAGAACTAAAACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902671129_902671133 12 Left 902671129 1:17974609-17974631 CCAGCATCTTGTGGGCATGTCAC No data
Right 902671133 1:17974644-17974666 GGAGGCAGAACTAAAACTGCTGG No data
902671128_902671133 13 Left 902671128 1:17974608-17974630 CCCAGCATCTTGTGGGCATGTCA No data
Right 902671133 1:17974644-17974666 GGAGGCAGAACTAAAACTGCTGG No data
902671132_902671133 -10 Left 902671132 1:17974631-17974653 CCAACATTGCAAAGGAGGCAGAA No data
Right 902671133 1:17974644-17974666 GGAGGCAGAACTAAAACTGCTGG No data
902671125_902671133 25 Left 902671125 1:17974596-17974618 CCGTGGGGTTCTCCCAGCATCTT No data
Right 902671133 1:17974644-17974666 GGAGGCAGAACTAAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902671133 Original CRISPR GGAGGCAGAACTAAAACTGC TGG Intergenic
No off target data available for this crispr