ID: 902672295

View in Genome Browser
Species Human (GRCh38)
Location 1:17983222-17983244
Sequence AGCCCTCAGCTCCCAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902672295_902672299 10 Left 902672295 1:17983222-17983244 CCAGCCCCTGGGAGCTGAGGGCT No data
Right 902672299 1:17983255-17983277 TTTTCTGTTCATGAAGTCACTGG No data
902672295_902672300 16 Left 902672295 1:17983222-17983244 CCAGCCCCTGGGAGCTGAGGGCT No data
Right 902672300 1:17983261-17983283 GTTCATGAAGTCACTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902672295 Original CRISPR AGCCCTCAGCTCCCAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr