ID: 902673771

View in Genome Browser
Species Human (GRCh38)
Location 1:17994191-17994213
Sequence GGGCCTGGTGACCGAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902673763_902673771 21 Left 902673763 1:17994147-17994169 CCCTCATTGTACATTCACAAACA No data
Right 902673771 1:17994191-17994213 GGGCCTGGTGACCGAGATGCAGG No data
902673764_902673771 20 Left 902673764 1:17994148-17994170 CCTCATTGTACATTCACAAACAC No data
Right 902673771 1:17994191-17994213 GGGCCTGGTGACCGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902673771 Original CRISPR GGGCCTGGTGACCGAGATGC AGG Intergenic