ID: 902673996

View in Genome Browser
Species Human (GRCh38)
Location 1:17995717-17995739
Sequence CGGTGTTAGATCTGAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902673991_902673996 5 Left 902673991 1:17995689-17995711 CCAGAGTCCAAGATCAAAGTGTC No data
Right 902673996 1:17995717-17995739 CGGTGTTAGATCTGAAACTCTGG No data
902673993_902673996 -2 Left 902673993 1:17995696-17995718 CCAAGATCAAAGTGTCCAAGGCG No data
Right 902673996 1:17995717-17995739 CGGTGTTAGATCTGAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902673996 Original CRISPR CGGTGTTAGATCTGAAACTC TGG Intergenic
No off target data available for this crispr