ID: 902677982

View in Genome Browser
Species Human (GRCh38)
Location 1:18022235-18022257
Sequence ATTATTTACGAGAGCAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902677982_902677988 4 Left 902677982 1:18022235-18022257 CCACCTCTGCTCTCGTAAATAAT No data
Right 902677988 1:18022262-18022284 TCTTGGCCTTTCTTGCTGGGAGG No data
902677982_902677986 0 Left 902677982 1:18022235-18022257 CCACCTCTGCTCTCGTAAATAAT No data
Right 902677986 1:18022258-18022280 CCACTCTTGGCCTTTCTTGCTGG No data
902677982_902677987 1 Left 902677982 1:18022235-18022257 CCACCTCTGCTCTCGTAAATAAT No data
Right 902677987 1:18022259-18022281 CACTCTTGGCCTTTCTTGCTGGG No data
902677982_902677990 18 Left 902677982 1:18022235-18022257 CCACCTCTGCTCTCGTAAATAAT No data
Right 902677990 1:18022276-18022298 GCTGGGAGGTGTTACGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902677982 Original CRISPR ATTATTTACGAGAGCAGAGG TGG (reversed) Intergenic
No off target data available for this crispr