ID: 902680572

View in Genome Browser
Species Human (GRCh38)
Location 1:18041235-18041257
Sequence GCCCCTCAGGATAATGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902680565_902680572 13 Left 902680565 1:18041199-18041221 CCTCATCTAGAAAAACAGGAACC No data
Right 902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG No data
902680567_902680572 -8 Left 902680567 1:18041220-18041242 CCACAAGGTCTGCCTGCCCCTCA No data
Right 902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG No data
902680563_902680572 22 Left 902680563 1:18041190-18041212 CCTGGGTCACCTCATCTAGAAAA No data
Right 902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902680572 Original CRISPR GCCCCTCAGGATAATGGTGA GGG Intergenic
No off target data available for this crispr