ID: 902688619

View in Genome Browser
Species Human (GRCh38)
Location 1:18095581-18095603
Sequence GGGTTGGAACAGATAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688619_902688630 18 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688619_902688626 9 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688626 1:18095613-18095635 ATCCTGATGAAAGCTGGACCTGG No data
902688619_902688624 3 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688624 1:18095607-18095629 AACCTAATCCTGATGAAAGCTGG No data
902688619_902688627 10 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688619_902688629 17 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688629 1:18095621-18095643 GAAAGCTGGACCTGGGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688619 Original CRISPR GGGTTGGAACAGATAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr