ID: 902688621

View in Genome Browser
Species Human (GRCh38)
Location 1:18095597-18095619
Sequence TCAGGATTAGGTTGTTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688621_902688627 -6 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688621_902688634 20 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688634 1:18095640-18095662 CTGGGATGCAGCTTTCAGAGGGG No data
902688621_902688636 27 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688636 1:18095647-18095669 GCAGCTTTCAGAGGGGGCATTGG No data
902688621_902688626 -7 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688626 1:18095613-18095635 ATCCTGATGAAAGCTGGACCTGG No data
902688621_902688632 18 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688632 1:18095638-18095660 TGCTGGGATGCAGCTTTCAGAGG No data
902688621_902688635 21 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688635 1:18095641-18095663 TGGGATGCAGCTTTCAGAGGGGG No data
902688621_902688629 1 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688629 1:18095621-18095643 GAAAGCTGGACCTGGGTTGCTGG No data
902688621_902688633 19 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688633 1:18095639-18095661 GCTGGGATGCAGCTTTCAGAGGG No data
902688621_902688630 2 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688621 Original CRISPR TCAGGATTAGGTTGTTGGGT TGG (reversed) Intergenic
No off target data available for this crispr