ID: 902688622

View in Genome Browser
Species Human (GRCh38)
Location 1:18095601-18095623
Sequence TTCATCAGGATTAGGTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688622_902688633 15 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688633 1:18095639-18095661 GCTGGGATGCAGCTTTCAGAGGG No data
902688622_902688627 -10 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688622_902688635 17 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688635 1:18095641-18095663 TGGGATGCAGCTTTCAGAGGGGG No data
902688622_902688629 -3 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688629 1:18095621-18095643 GAAAGCTGGACCTGGGTTGCTGG No data
902688622_902688634 16 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688634 1:18095640-18095662 CTGGGATGCAGCTTTCAGAGGGG No data
902688622_902688636 23 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688636 1:18095647-18095669 GCAGCTTTCAGAGGGGGCATTGG No data
902688622_902688630 -2 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688622_902688632 14 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688632 1:18095638-18095660 TGCTGGGATGCAGCTTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688622 Original CRISPR TTCATCAGGATTAGGTTGTT GGG (reversed) Intergenic
No off target data available for this crispr