ID: 902688623

View in Genome Browser
Species Human (GRCh38)
Location 1:18095602-18095624
Sequence TTTCATCAGGATTAGGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688623_902688635 16 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688635 1:18095641-18095663 TGGGATGCAGCTTTCAGAGGGGG No data
902688623_902688634 15 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688634 1:18095640-18095662 CTGGGATGCAGCTTTCAGAGGGG No data
902688623_902688629 -4 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688629 1:18095621-18095643 GAAAGCTGGACCTGGGTTGCTGG No data
902688623_902688630 -3 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688623_902688636 22 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688636 1:18095647-18095669 GCAGCTTTCAGAGGGGGCATTGG No data
902688623_902688632 13 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688632 1:18095638-18095660 TGCTGGGATGCAGCTTTCAGAGG No data
902688623_902688633 14 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688633 1:18095639-18095661 GCTGGGATGCAGCTTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688623 Original CRISPR TTTCATCAGGATTAGGTTGT TGG (reversed) Intergenic
No off target data available for this crispr