ID: 902688624

View in Genome Browser
Species Human (GRCh38)
Location 1:18095607-18095629
Sequence AACCTAATCCTGATGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688620_902688624 -1 Left 902688620 1:18095585-18095607 CCTCTATCTGTTCCAACCCAACA No data
Right 902688624 1:18095607-18095629 AACCTAATCCTGATGAAAGCTGG No data
902688619_902688624 3 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688624 1:18095607-18095629 AACCTAATCCTGATGAAAGCTGG No data
902688618_902688624 18 Left 902688618 1:18095566-18095588 CCTGGCAGATGGAAACCATCCTC No data
Right 902688624 1:18095607-18095629 AACCTAATCCTGATGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688624 Original CRISPR AACCTAATCCTGATGAAAGC TGG Intergenic
No off target data available for this crispr