ID: 902688625

View in Genome Browser
Species Human (GRCh38)
Location 1:18095609-18095631
Sequence GTCCAGCTTTCATCAGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688625_902688630 -10 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688625_902688633 7 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688633 1:18095639-18095661 GCTGGGATGCAGCTTTCAGAGGG No data
902688625_902688635 9 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688635 1:18095641-18095663 TGGGATGCAGCTTTCAGAGGGGG No data
902688625_902688632 6 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688632 1:18095638-18095660 TGCTGGGATGCAGCTTTCAGAGG No data
902688625_902688634 8 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688634 1:18095640-18095662 CTGGGATGCAGCTTTCAGAGGGG No data
902688625_902688636 15 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688636 1:18095647-18095669 GCAGCTTTCAGAGGGGGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688625 Original CRISPR GTCCAGCTTTCATCAGGATT AGG (reversed) Intergenic
No off target data available for this crispr