ID: 902688626

View in Genome Browser
Species Human (GRCh38)
Location 1:18095613-18095635
Sequence ATCCTGATGAAAGCTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688619_902688626 9 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688626 1:18095613-18095635 ATCCTGATGAAAGCTGGACCTGG No data
902688620_902688626 5 Left 902688620 1:18095585-18095607 CCTCTATCTGTTCCAACCCAACA No data
Right 902688626 1:18095613-18095635 ATCCTGATGAAAGCTGGACCTGG No data
902688618_902688626 24 Left 902688618 1:18095566-18095588 CCTGGCAGATGGAAACCATCCTC No data
Right 902688626 1:18095613-18095635 ATCCTGATGAAAGCTGGACCTGG No data
902688621_902688626 -7 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688626 1:18095613-18095635 ATCCTGATGAAAGCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688626 Original CRISPR ATCCTGATGAAAGCTGGACC TGG Intergenic
No off target data available for this crispr