ID: 902688627

View in Genome Browser
Species Human (GRCh38)
Location 1:18095614-18095636
Sequence TCCTGATGAAAGCTGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688618_902688627 25 Left 902688618 1:18095566-18095588 CCTGGCAGATGGAAACCATCCTC No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688622_902688627 -10 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688619_902688627 10 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688620_902688627 6 Left 902688620 1:18095585-18095607 CCTCTATCTGTTCCAACCCAACA No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data
902688621_902688627 -6 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688627 1:18095614-18095636 TCCTGATGAAAGCTGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688627 Original CRISPR TCCTGATGAAAGCTGGACCT GGG Intergenic
No off target data available for this crispr