ID: 902688630

View in Genome Browser
Species Human (GRCh38)
Location 1:18095622-18095644
Sequence AAAGCTGGACCTGGGTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902688622_902688630 -2 Left 902688622 1:18095601-18095623 CCCAACAACCTAATCCTGATGAA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688621_902688630 2 Left 902688621 1:18095597-18095619 CCAACCCAACAACCTAATCCTGA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688625_902688630 -10 Left 902688625 1:18095609-18095631 CCTAATCCTGATGAAAGCTGGAC No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688623_902688630 -3 Left 902688623 1:18095602-18095624 CCAACAACCTAATCCTGATGAAA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688620_902688630 14 Left 902688620 1:18095585-18095607 CCTCTATCTGTTCCAACCCAACA No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data
902688619_902688630 18 Left 902688619 1:18095581-18095603 CCATCCTCTATCTGTTCCAACCC No data
Right 902688630 1:18095622-18095644 AAAGCTGGACCTGGGTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902688630 Original CRISPR AAAGCTGGACCTGGGTTGCT GGG Intergenic
No off target data available for this crispr