ID: 902692379

View in Genome Browser
Species Human (GRCh38)
Location 1:18117981-18118003
Sequence ATGCCAGGCTCTTCAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 186}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902692379_902692391 10 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692391 1:18118014-18118036 CTGGGTCCCCTGAAATTGGGTGG 0: 1
1: 0
2: 2
3: 10
4: 142
902692379_902692385 -9 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692385 1:18117995-18118017 GCCTGGCATGGGGAAGCCTCTGG 0: 1
1: 0
2: 2
3: 45
4: 449
902692379_902692390 7 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692390 1:18118011-18118033 CCTCTGGGTCCCCTGAAATTGGG 0: 1
1: 0
2: 0
3: 10
4: 182
902692379_902692388 6 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692388 1:18118010-18118032 GCCTCTGGGTCCCCTGAAATTGG 0: 1
1: 0
2: 1
3: 19
4: 137
902692379_902692393 12 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692393 1:18118016-18118038 GGGTCCCCTGAAATTGGGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 118
902692379_902692392 11 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692392 1:18118015-18118037 TGGGTCCCCTGAAATTGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 124
902692379_902692397 19 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692397 1:18118023-18118045 CTGAAATTGGGTGGGGACCTTGG 0: 1
1: 0
2: 0
3: 16
4: 199
902692379_902692387 -8 Left 902692379 1:18117981-18118003 CCACCACCTGAAGAGCCTGGCAT 0: 1
1: 0
2: 2
3: 18
4: 186
Right 902692387 1:18117996-18118018 CCTGGCATGGGGAAGCCTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902692379 Original CRISPR ATGCCAGGCTCTTCAGGTGG TGG (reversed) Intronic
901740314 1:11337982-11338004 GACCCAGGCTCTTCAGGTGAAGG - Intergenic
902447879 1:16478594-16478616 AAGCCAGGTTCTTCTGCTGGAGG - Intergenic
902692379 1:18117981-18118003 ATGCCAGGCTCTTCAGGTGGTGG - Intronic
902981154 1:20124311-20124333 CTGGCAAGCTCTCCAGGTGGAGG + Intergenic
903283623 1:22263960-22263982 GTGCCAGGCTCTTCACTGGGTGG + Intergenic
903421520 1:23220695-23220717 ATTCAAGGCTCTTCACGTGCTGG - Intergenic
903908306 1:26702631-26702653 ATGCTAGCCTCCTCATGTGGTGG + Intronic
904317318 1:29673823-29673845 ATGCCAGGCAGCTCAGGAGGTGG + Intergenic
912205141 1:107500488-107500510 CTGCCAGTCTCTTCAGGTTCTGG - Intergenic
912683173 1:111741614-111741636 AAGCCAGGCCCTTCAAGTTGGGG - Intronic
913955130 1:143283164-143283186 ATGTCAGGCTCTTCAACTGCTGG - Intergenic
913982307 1:143532276-143532298 ATGTCAGGCTCTTCAACTGCTGG + Intergenic
917960963 1:180144230-180144252 ATGCCAAGCTCTGCAGTTGGTGG - Intergenic
918307946 1:183264347-183264369 GTGCCAGGCTGTTCAGTGGGCGG + Intronic
919660276 1:200237319-200237341 ATCCCAGGCATTTCAGGTGAGGG - Intergenic
920100582 1:203514689-203514711 ATGCCAGGGACTCCAGGTGCTGG + Intergenic
920246701 1:204593267-204593289 AAGACAGTCTCTTCAGGGGGTGG + Intergenic
920305289 1:205014670-205014692 ATGCCAGGCTGTTGAGGGGACGG - Intronic
921677700 1:217994513-217994535 ATGCCAGTATGGTCAGGTGGAGG - Intergenic
924900300 1:248390614-248390636 TTCCGAGGCTCTTCAGCTGGAGG + Intergenic
1062873080 10:923411-923433 ATACCAGGCTCTCCATCTGGAGG - Intronic
1063460675 10:6213205-6213227 ATGCCAGGGGCTTCAGGATGGGG + Intronic
1065563713 10:26988571-26988593 TTGCCATTCTCTTCAGGTGAAGG + Intergenic
1067411462 10:46068437-46068459 TTTCCAGCCTCTTCAGGAGGAGG - Intergenic
1068279988 10:54855227-54855249 ATGCCTGGTTCTGCAGGTGCAGG + Intronic
1071030929 10:81180388-81180410 AGACCAGGCTATTCATGTGGTGG - Intergenic
1074125467 10:110525634-110525656 AAGTCAGGATGTTCAGGTGGTGG + Intergenic
1076720417 10:132389951-132389973 ATGCCAGGTTCTGCATGTGGAGG + Intergenic
1077979798 11:7288166-7288188 ACCCCAGACTCTTGAGGTGGAGG + Intronic
1080421066 11:32110870-32110892 AGAACAGGCTCTTCAGGAGGAGG - Intergenic
1082671260 11:56039515-56039537 ATTCCAGGTTCTTCAGCTGTGGG + Intergenic
1083164075 11:60872914-60872936 ATGCCAGGCCCTGCACCTGGTGG - Intronic
1084675004 11:70629167-70629189 GGGCCAGGCTCTTCCGGTGCTGG - Intronic
1085875465 11:80402151-80402173 TTGCCAGATTCTACAGGTGGAGG - Intergenic
1086123517 11:83326346-83326368 AAGCCAGGCTGGGCAGGTGGGGG + Intergenic
1090038009 11:123265329-123265351 ATCCCAGCCTCTTCAGGAGCTGG - Intergenic
1092558921 12:9588871-9588893 ATCCCAGGCTGTTCACATGGTGG - Intergenic
1092657642 12:10703905-10703927 ATGCCAGAGTTTTCAGGTGGTGG - Intronic
1093920154 12:24850397-24850419 ATGGCAGGGTCTTCAGCAGGTGG + Intronic
1094074522 12:26458243-26458265 CTGCCAGGCTGTCCAGGTGAGGG + Intronic
1094158595 12:27364759-27364781 ATGCCAGGCTTTTGAATTGGAGG - Intronic
1096094521 12:48925460-48925482 AGGACAGGCTGTTCGGGTGGCGG + Exonic
1096115361 12:49051914-49051936 ATGGGTGACTCTTCAGGTGGAGG + Exonic
1096253592 12:50049775-50049797 AGGCAAGGCATTTCAGGTGGAGG - Intergenic
1096481070 12:51941410-51941432 AGCCCAGGCTCTGCAGCTGGCGG + Intergenic
1096584560 12:52611403-52611425 CTGCCAGGCTCTGCAAGTGCAGG - Intronic
1096949398 12:55450445-55450467 CTGCCAGGCTCTTCATGGGCAGG - Intergenic
1099028588 12:77496305-77496327 CTGGCAGGCTCTTCAAGAGGTGG + Intergenic
1103078548 12:118005011-118005033 ACGCCAGGCCCTTCAAGGGGAGG + Intergenic
1103896127 12:124274469-124274491 CTGCCAGGCCCTTCTGGGGGAGG + Intronic
1103943173 12:124511821-124511843 ACGCCAGTCTCTGGAGGTGGGGG - Intronic
1106816282 13:33410818-33410840 ATGTCAGGCTGTGCAGGAGGTGG + Intergenic
1110553730 13:76835215-76835237 TTACCAGGGTCTTCATGTGGTGG + Intergenic
1115178195 14:30590338-30590360 ATGCCAAAGTCTTGAGGTGGAGG + Intronic
1116993239 14:51297390-51297412 ATGCCAGGCCCATGAGGTAGGGG - Intergenic
1117510781 14:56448742-56448764 ATGGAAGGATCATCAGGTGGGGG + Intergenic
1119062421 14:71488946-71488968 ATTCCAGGCTCCTCAGCTGCAGG + Intronic
1121089561 14:91171637-91171659 ATAGCAAGCTCTTTAGGTGGTGG + Intronic
1121128840 14:91427305-91427327 ATGCCAGGATGTCCAGGTAGGGG + Intergenic
1122770817 14:104096887-104096909 AGGCCAGGGTTTTCAGGAGGAGG - Intronic
1126462378 15:48927540-48927562 ATGCCAGGGGTTTCATGTGGTGG - Intronic
1128349224 15:66877923-66877945 ATGCCAGGCTCTTGGCTTGGTGG - Intergenic
1128721830 15:69955780-69955802 ATCCCAGGCTCTCCAGGCTGTGG + Intergenic
1128834568 15:70798805-70798827 ATGCCAGCCTAATCAAGTGGTGG + Intergenic
1130769269 15:86907788-86907810 CTGGCAGGGTCTTCAGGTGCTGG + Intronic
1131114206 15:89784208-89784230 TTGCCAGGCTCATAAAGTGGGGG - Intergenic
1131358982 15:91772597-91772619 ATGCCAGGCTCTGGGGGTGGGGG + Intergenic
1132852878 16:2032817-2032839 GTGCCAGGCCCTGGAGGTGGTGG + Intronic
1134861396 16:17563715-17563737 ATTCCAGGTTCTTCAGCTGTGGG - Intergenic
1135772663 16:25229070-25229092 ATGGCAGGCTCTTGAAGTTGAGG + Intergenic
1136027209 16:27476381-27476403 AGGCCAGGCTCGTGAGGTGCTGG - Intronic
1136596394 16:31253133-31253155 GTGCCATGGCCTTCAGGTGGTGG + Intergenic
1138677969 16:58665636-58665658 ATGCTAGGGGCTCCAGGTGGAGG + Exonic
1139030230 16:62871563-62871585 ATGCCAAGTTCTTCAGGTTTGGG + Intergenic
1141860738 16:86714455-86714477 ATGCCTGGGTCTTCAGACGGGGG + Intergenic
1142558899 17:798370-798392 AAACCAGGCCCTGCAGGTGGAGG - Intergenic
1144024737 17:11268026-11268048 AGGACAGGCTCTTTAGGAGGGGG - Intronic
1144301015 17:13923119-13923141 ATCCCAGGCTATGGAGGTGGAGG - Intergenic
1144554259 17:16267882-16267904 GTCCCAGGCTCTCCTGGTGGAGG + Intronic
1144677095 17:17168586-17168608 ATGCCAGGCCCTGGAGGTGGTGG + Intronic
1150939001 17:69669777-69669799 ATGCAATGCCCTTCAGGGGGTGG + Intergenic
1151979913 17:77502664-77502686 CTGCCAGGAACTTCAGATGGGGG - Intergenic
1152344531 17:79743090-79743112 AGTCCAGGCTCTTCAGGCTGAGG - Intergenic
1154338545 18:13484718-13484740 GTGCCTGTCTCTCCAGGTGGGGG - Intronic
1155186968 18:23395541-23395563 AGGCCAGGGTCTGCAGCTGGAGG - Intronic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1160374825 18:78403691-78403713 ATTCCAGGCTCTGCAGCTGCAGG + Intergenic
1161846534 19:6714327-6714349 ATGTCAGGTTCTTGAGGAGGGGG - Intronic
1162018426 19:7857837-7857859 ATGCCAGACTCTGCCGGTGAGGG - Intronic
1162739024 19:12763422-12763444 AGGCCATGCCCTTCAGGAGGAGG + Exonic
1164579020 19:29422909-29422931 CTGCCAGGCTATTCTGGAGGTGG + Intergenic
1168283903 19:55321035-55321057 ATGCCGGGCTCTGCAGGTGAAGG + Exonic
925232487 2:2246132-2246154 ATACCAGGTGCCTCAGGTGGAGG - Intronic
925423189 2:3728056-3728078 ATGCTGAGCTCTTCATGTGGGGG + Intronic
926302267 2:11612848-11612870 TTGCCAGGCTCTACGGGTGGAGG + Intronic
928294493 2:30070889-30070911 ATGCCAGGCTCTGCATGTGATGG - Intergenic
930848968 2:55937444-55937466 ATGCCATGTTCTTCAGGTTTTGG - Intergenic
934164420 2:89281308-89281330 ATGCTTGGATCTTAAGGTGGAGG + Intergenic
934202854 2:89901216-89901238 ATGCTTGGATCTTAAGGTGGAGG - Intergenic
935747267 2:106199406-106199428 ATGGCAGGCACCTCAGGAGGAGG - Intergenic
936685405 2:114821396-114821418 CTGCCAGGCTCTAAAAGTGGGGG + Intronic
937313478 2:120916387-120916409 ATGGCAGGCTCTTCAGGCTCAGG - Intronic
940838916 2:158556946-158556968 ATGCCATGATCTTCAGGGTGTGG - Intronic
944405613 2:199380343-199380365 AGGTCAGTATCTTCAGGTGGGGG - Exonic
945039681 2:205733523-205733545 CTGCCTGCCTCTTCAGGTGGAGG - Intronic
946040949 2:216782321-216782343 ATGCCACCCTGTTCAGCTGGGGG - Intergenic
947430614 2:230024521-230024543 ATGCCAGGCTGCACAGGTAGGGG - Intergenic
947602468 2:231462884-231462906 ATGCCCAGCTCTACATGTGGGGG + Intronic
947766971 2:232644133-232644155 ATGCCAGGCTCTTTGGAGGGAGG - Intronic
948260546 2:236601250-236601272 ATGCCAGGTACTGGAGGTGGAGG - Intergenic
948462912 2:238138906-238138928 AAGCCAGGCTCCTCAGGGTGGGG + Intronic
1169629226 20:7607750-7607772 AGGCCAGTCTCTTCAGATAGTGG - Intergenic
1170624199 20:18019020-18019042 AGGCCAGTGTCTTCAGGTAGGGG + Intronic
1172882984 20:38213626-38213648 ATGCCAGTCGCTGCAGGTAGCGG + Exonic
1173685962 20:44923813-44923835 AAGCCAAGCTCTCCAGATGGTGG - Intronic
1174370677 20:50085347-50085369 TTGCAAGGCATTTCAGGTGGGGG - Intronic
1175870408 20:62206674-62206696 ATGACCGGCTCTGAAGGTGGAGG + Intergenic
1176077634 20:63255448-63255470 ATCTCAGGCTCCTCAGGCGGTGG - Intronic
1180612112 22:17104795-17104817 ATGCCAGACACTCCAGGTAGGGG + Exonic
1180801156 22:18632558-18632580 ATGCCAGGCTGCAGAGGTGGAGG + Intergenic
1181386281 22:22548213-22548235 AGGCAAGCCTCTCCAGGTGGAGG + Exonic
1182118893 22:27774361-27774383 ATGCCAGCTTCTTCAGTTGGTGG - Intronic
1182430771 22:30297698-30297720 AGGGCAGGCTCTGCAGGTGCTGG - Intronic
1184549776 22:45198293-45198315 CTCCCATGCTCTGCAGGTGGCGG - Intronic
1184838466 22:47038224-47038246 AAGCCTGGCTCTTGAGGTGCCGG - Intronic
949915570 3:8961099-8961121 ATGCCATCCTCTTCTGGTGGAGG + Intronic
953057369 3:39398750-39398772 TTTCCTGCCTCTTCAGGTGGTGG + Intergenic
953597060 3:44326656-44326678 ATGCCAGACTAATCAGGAGGAGG + Intronic
954276885 3:49548070-49548092 ATGCCAGGCCTTCCAGCTGGAGG + Intergenic
956892939 3:73630263-73630285 ACGCCAGGCCCTACAGATGGTGG - Intergenic
957154097 3:76524772-76524794 ATGCCAGGCTTTCCAGCAGGGGG + Intronic
959546253 3:107599833-107599855 ATTCCAGGCTCTTTTGGTGGCGG + Intronic
961605902 3:128095239-128095261 ATGCCAGGCTCTGCAGGTATGGG + Intronic
962191666 3:133317399-133317421 ATGCCAAGATCTTCAGGAGTTGG - Intronic
962506522 3:136051766-136051788 ATGACAGGCTTTGCAGGTGCTGG - Intronic
964740781 3:159963467-159963489 ATGCCTGGCTACTCAGGAGGCGG - Intergenic
967598486 3:191356363-191356385 TTGCCTGGCTCTTCAGGTGGAGG + Intronic
968106944 3:196007927-196007949 CTGCCAGGCTCTGGGGGTGGCGG + Intergenic
969866147 4:10078203-10078225 CTGCCAGGTCCTTCAGGTGCCGG - Intronic
971389508 4:26172920-26172942 ATGCCTGGCTTTGGAGGTGGGGG + Intronic
973257530 4:48128317-48128339 AAGCCAGGCGCTCCAGGTTGTGG + Intronic
973716864 4:53685435-53685457 GTGCCAGGCACTTAAGGTGCTGG + Intronic
974070356 4:57117971-57117993 ATGTCAGGGTCTTCAGGAGCAGG + Intergenic
974782647 4:66573512-66573534 ATGAGAGGCTCTTCATTTGGTGG + Intergenic
975736748 4:77388779-77388801 ATCCCAGGCTCCTCGGGTTGGGG + Intronic
976047500 4:80968587-80968609 AGGCTAGTCTCTTCAGCTGGGGG - Intergenic
977824336 4:101512464-101512486 CTTCCAGGCTCTTCAGGCAGAGG - Intronic
981110952 4:140932743-140932765 ATGACAAGCTCTCCTGGTGGTGG + Intronic
981663816 4:147198806-147198828 AAGCCAGTCTCTTCATGTCGAGG + Intergenic
981845186 4:149159721-149159743 AGGACAGGCCCTTCAGGGGGTGG + Intergenic
981892554 4:149755450-149755472 ATGCAAATATCTTCAGGTGGGGG - Intergenic
981974951 4:150715322-150715344 TTGCCAGGCTATTCTGGTGGTGG + Intronic
983893009 4:173050372-173050394 ATACCAGGCACTTCAAGTAGGGG - Intergenic
984249334 4:177312650-177312672 ATGCCAGGCTTTTTATGTGTGGG - Intronic
985946861 5:3192190-3192212 ATGCCAGTGTCATCAGGAGGGGG - Intergenic
986368002 5:7054508-7054530 CTGCCTGGCTCTTCAGGTGACGG - Intergenic
988211742 5:28213445-28213467 ATGACAGGATCTTCAGATAGTGG + Intergenic
988448502 5:31315053-31315075 ATTTCTGGCTCTTCAGGTCGAGG - Intronic
992177249 5:74162159-74162181 CTGTCAGGCTCATCAGGAGGAGG + Intergenic
992502018 5:77352189-77352211 AGGCCAGGCTGCTCAGGAGGAGG - Intronic
998400899 5:141848681-141848703 GTGCCAGGGTCTGGAGGTGGAGG - Intergenic
998821147 5:146059142-146059164 ATCCCAGGCTTTCCAGGAGGAGG + Intronic
999513409 5:152276531-152276553 ATGCCAGATTCTTCAGGGTGTGG + Intergenic
1000855894 5:166397633-166397655 ATGCCAGGATCTCCAGATGCAGG + Intergenic
1001949354 5:175805576-175805598 CTGCCCGGCTCATCAGGTGGAGG - Intronic
1003148655 6:3530351-3530373 ATCCCAGGCTTTTCAGGTGGTGG - Intergenic
1006813767 6:36837679-36837701 AGGCCAGGCTTTTCAGGAGTGGG + Intronic
1007128251 6:39445818-39445840 ATGCCAAGCCCTTCACCTGGTGG - Intronic
1007206977 6:40160752-40160774 ATGGCTGGCTCTCCAAGTGGAGG - Intergenic
1007482519 6:42159373-42159395 ATGCCAGGCTCTTGGTGTGAAGG - Intronic
1007700059 6:43761182-43761204 ATGCCAGGGTCTTATGGAGGGGG + Intergenic
1008565024 6:52759286-52759308 ATGCCAGGCTGTTTGGGTGGTGG + Intronic
1008789213 6:55209468-55209490 ATGACAGCCTCTTCATGTAGAGG - Intronic
1013959147 6:115876993-115877015 ATGCCAAGCTATTCAGATGAGGG + Intergenic
1017002756 6:150007161-150007183 ATGTCAGGCTCACCAGGTGATGG - Intergenic
1019176927 6:170164720-170164742 ATGGCTGGCTCTGCAGGTGGAGG + Intergenic
1019812029 7:3171916-3171938 ATGCCAAGATCTCCTGGTGGAGG - Intronic
1019861991 7:3667608-3667630 CTGCCAGGGTCTCCTGGTGGAGG - Intronic
1020229483 7:6306730-6306752 ATGCCAGGCTCTGGGGGAGGGGG + Intergenic
1022382446 7:29873101-29873123 AGGCCAGGCATTTCAGGTGAGGG - Intronic
1023669368 7:42560199-42560221 ATGCCTGGATATCCAGGTGGAGG + Intergenic
1024825733 7:53387612-53387634 GAGCCAGGCTCCGCAGGTGGAGG - Intergenic
1025082570 7:55996364-55996386 AAGAAAGGCGCTTCAGGTGGAGG - Intronic
1027641395 7:80737705-80737727 AAGCCAAGCTCCTCATGTGGAGG + Intergenic
1027829072 7:83155094-83155116 GGGCCAGGCTGTTGAGGTGGGGG + Exonic
1027829085 7:83155154-83155176 GAGCCAGGCTGTTGAGGTGGGGG + Exonic
1027829094 7:83155184-83155206 GGGCCAGGCTGTTGAGGTGGGGG + Exonic
1035984800 8:4415436-4415458 ATAACACGCTCTTCAGGTCGTGG + Intronic
1037998887 8:23373761-23373783 AAGCCAGGATCTGAAGGTGGTGG + Intronic
1038308380 8:26425090-26425112 AAGCCTGTCTCTGCAGGTGGGGG + Intronic
1042126550 8:65543221-65543243 ATGCCAGGGTCTGCAGGGAGGGG + Intergenic
1044632556 8:94293317-94293339 GTGCCAGGCTCCTTGGGTGGAGG - Intergenic
1045890954 8:107156616-107156638 ATGGCAGGCTTTAAAGGTGGAGG - Intergenic
1048013341 8:130476311-130476333 AGGCCACGGTCTTCAGGGGGAGG - Intergenic
1054830297 9:69617532-69617554 ATTTCTGGCTCTTAAGGTGGAGG - Intronic
1055332363 9:75197489-75197511 TAGCCAGGCTCTTCAGATGCTGG - Intergenic
1055469968 9:76601472-76601494 ATGTCAGTCTCTTCAGTTTGGGG + Intergenic
1057747324 9:97762527-97762549 AGTCCAGGCTCTTGGGGTGGAGG + Intergenic
1062378249 9:136274651-136274673 AAGCCAGCCTCTGCAGGTGACGG - Intergenic
1062717345 9:138017861-138017883 AGGCCAGGCCCTGCAGGTGAGGG + Intronic
1187094448 X:16131624-16131646 TTGCCAGGATCTGTAGGTGGAGG - Intronic
1192190164 X:68986258-68986280 TTGGCAGGCTCTTGAGTTGGTGG - Intergenic
1192427922 X:71093784-71093806 ATGCCAGGCTCCTCAGATTCAGG - Intergenic
1195795470 X:108642275-108642297 AGGAAAGGCTCATCAGGTGGGGG - Intronic
1196349839 X:114715356-114715378 ATAACAGGCTCTTCTGGTTGTGG - Intronic
1199808680 X:151327678-151327700 ATGCCAGCCTCACCAGGTGCTGG - Intergenic
1199975236 X:152891244-152891266 ATGCCATTATCATCAGGTGGAGG + Intergenic