ID: 902692975

View in Genome Browser
Species Human (GRCh38)
Location 1:18121794-18121816
Sequence ACTTGGACATTGAGAGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902692975 Original CRISPR ACTTGGACATTGAGAGCCAA TGG (reversed) Intronic
902056680 1:13606445-13606467 ACTTGGACAATTAGAACCACAGG - Intronic
902692975 1:18121794-18121816 ACTTGGACATTGAGAGCCAATGG - Intronic
903198770 1:21715147-21715169 ACTTGGACAATGACAGTCATGGG + Intronic
904775327 1:32902542-32902564 ACTTGGGCACAGAGACCCAAGGG - Intergenic
908949346 1:69540927-69540949 AATAGGACAGAGAGAGCCAAGGG + Intergenic
910617566 1:89216265-89216287 ACTTGAACATTGAGAACACATGG - Intergenic
912078567 1:105909398-105909420 CCTTGGCCAGTGAGAGCAAAGGG - Intergenic
914254342 1:145949039-145949061 ACTTTGAGATTTAGAGACAAAGG - Intronic
916413446 1:164570409-164570431 AGTTGGACAATGAGAGCACATGG - Intronic
918558096 1:185829459-185829481 AGTTGAACATTGAGAACAAATGG - Intronic
920348545 1:205322301-205322323 ACTTGGATATTGGAATCCAATGG + Intergenic
920712444 1:208308209-208308231 TCATTGACATCGAGAGCCAATGG + Intergenic
921044451 1:211464281-211464303 TCATGGACATGGAGAGCAAAAGG + Intergenic
922221488 1:223611736-223611758 ACATGCACTTTGTGAGCCAAGGG + Intronic
923883798 1:238132637-238132659 AGTTGGACATTAACAGCAAAAGG + Intergenic
923902041 1:238336563-238336585 AGTTGGAGATTGGCAGCCAATGG + Intergenic
1064511392 10:16097042-16097064 AATTGAACATTGAGAGCACATGG + Intergenic
1065480898 10:26192990-26193012 TCTAGGACTTTGAGAGCTAAGGG - Intronic
1066297037 10:34063476-34063498 AGTTGGACAATGAGAACCCATGG + Intergenic
1070290418 10:75110227-75110249 CCCTAGACTTTGAGAGCCAAAGG + Intronic
1071173776 10:82899137-82899159 ACTTTGACAATGAGAACCTATGG - Intronic
1075052471 10:119193012-119193034 ACTTGGACTTTGAGAGATAATGG - Intergenic
1076495603 10:130895633-130895655 ACATGGAAATTGGGAGCCATGGG + Intergenic
1080457957 11:32432314-32432336 ACTTGGGCTGTGAGAGGCAAGGG - Intronic
1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG + Intronic
1085338266 11:75714078-75714100 ACTTGGACTCTGGGAGCCATCGG - Intergenic
1085944347 11:81248719-81248741 ATTTGGATTTGGAGAGCCAAGGG + Intergenic
1086318623 11:85620378-85620400 ACTTGAACACTGAGAGGCCATGG - Intronic
1086585388 11:88445437-88445459 AATTGGACAGAGAGAGTCAAGGG + Intergenic
1087574618 11:99975138-99975160 AATTGGAAATTTAGAGGCAAAGG + Intronic
1087775985 11:102257093-102257115 ACTTGGCCCTTGTGAGCCAGTGG - Intergenic
1088216496 11:107516251-107516273 ACATGTATATTGAGAGTCAATGG - Intronic
1088608169 11:111551311-111551333 ACTTAGCCAATGAGAGGCAAAGG - Intronic
1094280329 12:28730358-28730380 ATTTGGCCAATGAGAGCCACTGG + Intergenic
1094475017 12:30834087-30834109 ACTGGGACTTTGAGAGTCATAGG + Intergenic
1097021196 12:56021809-56021831 ACTTGGACAGTGGGAGCCTATGG + Intronic
1097413529 12:59284374-59284396 ACTTGGACACAGACACCCAAGGG - Intergenic
1098240910 12:68466048-68466070 TCTTGCACATTGGAAGCCAAAGG + Intergenic
1100885672 12:99067143-99067165 TTTTGGACATTGAGAACAAAAGG + Intronic
1101669970 12:106860470-106860492 ACTTGGAAAATGAAAGACAAAGG - Intronic
1103139388 12:118535442-118535464 ACTTGGAGATTCTGAGCCATTGG + Intergenic
1103227773 12:119302985-119303007 AATTGGCCAATGAGAGCCAGCGG - Intergenic
1110708867 13:78627477-78627499 AATTGAACATTGAGAGCACATGG - Intronic
1110738125 13:78962535-78962557 GCTTGGACATTGGCAGCCTATGG - Intergenic
1111320447 13:86621060-86621082 AGTTGAACATTGAGAGCACATGG + Intergenic
1111798229 13:92950643-92950665 ACTGGGCCATGGGGAGCCAAGGG - Intergenic
1115888399 14:37999918-37999940 AATTGGCCAGGGAGAGCCAAAGG + Intronic
1116393953 14:44425938-44425960 ACTTGGAAATTGAGAGTAGAAGG + Intergenic
1119434529 14:74589380-74589402 AATTGGACATTGTGCACCAAGGG + Intronic
1121112774 14:91323778-91323800 ACTTGGACTTCCAGAGGCAAGGG + Intronic
1121413561 14:93763709-93763731 GCTGGGACCTTGTGAGCCAAGGG - Intronic
1123803528 15:23847788-23847810 ACTTGGAAATTGAATGCAAAGGG + Intergenic
1124094148 15:26633117-26633139 ACTTGGGATTTGAGAGCAAAGGG - Intronic
1124994153 15:34706468-34706490 ACTGGGAGATTGAGAGAAAAGGG + Intergenic
1128396040 15:67226926-67226948 TCTTGGACATTGATATTCAAAGG - Intronic
1132373894 15:101315927-101315949 ACTGGGGCACTGTGAGCCAAGGG + Intronic
1134302715 16:13005831-13005853 CCTTGGACATTGACATCCTAGGG + Intronic
1134747854 16:16601750-16601772 ACTTGGATGTGGTGAGCCAAGGG + Intergenic
1134997614 16:18751913-18751935 ACTTGGATGTGGTGAGCCAAGGG - Intergenic
1136522927 16:30808866-30808888 GCTTGGACAGTGAGAGACTAGGG - Intergenic
1139845390 16:69917511-69917533 AATTAGAAATTGAGAGCTAATGG + Intronic
1140961742 16:79919373-79919395 ACTTGTTCATTAAGAACCAAAGG + Intergenic
1141749061 16:85946215-85946237 ACTTGGAAGTTGTCAGCCAAGGG - Intergenic
1144023248 17:11255592-11255614 ACTTGGACTTTGACAGCCAAAGG - Intronic
1149003192 17:51778065-51778087 ACTTGGACTCGGAGAGCAAAGGG - Intronic
1149099937 17:52893273-52893295 ACTTGAACATTGAGACCCAGAGG - Intronic
1149937547 17:60823748-60823770 ACATGGAGAATGAAAGCCAATGG + Intronic
1150758715 17:67940307-67940329 ACTGGGATATTCAGAGCCTAAGG - Intronic
1151435913 17:74097305-74097327 ACTCTGACATTGAGGACCAAGGG - Intergenic
1152056510 17:78032170-78032192 ACTAGGAAATTGAGAGAAAAGGG - Intronic
1152634831 17:81426656-81426678 TCTTGGATATTGAAAGTCAAAGG + Intronic
1152799024 17:82322568-82322590 ACTTGGAGTTTCTGAGCCAAGGG - Intronic
1153569463 18:6454288-6454310 TCTTAGACATTGAGAGGCATTGG - Intergenic
1156320934 18:36021521-36021543 ACTTGAACATTTAGAGGCCATGG - Intronic
1156388513 18:36628294-36628316 CTTTGGATATTAAGAGCCAAGGG - Intronic
1157149580 18:45203082-45203104 ACTTGGCCATTGAAAGAGAACGG + Intergenic
1157686659 18:49648259-49648281 ACTTGGCCATTGCAAGCCTATGG + Intergenic
1157862746 18:51155687-51155709 ACTTGGACATTAACTGCAAATGG + Intergenic
1160100898 18:75918132-75918154 ACTTGTACCTTGAGAGCCCCTGG - Intergenic
929950658 2:46407251-46407273 TCTTGGAAATGGAGGGCCAAAGG + Intergenic
930787800 2:55287582-55287604 ACTTAGACTTTGGGAGACAAAGG - Intergenic
930794369 2:55372339-55372361 ACATGGACTTTGAAAACCAATGG + Intronic
936497750 2:113037162-113037184 TCGTGGACGTTGAGAGCCATAGG - Intronic
938248590 2:129797073-129797095 AGTTGGATTTTGAGAGGCAAAGG + Intergenic
939826155 2:147017839-147017861 ACTTGGACTATAAGAGCCTATGG + Intergenic
940165761 2:150769044-150769066 CCTTGGACATTGAGTGGGAATGG - Intergenic
940446172 2:153780468-153780490 ACTTGGAAATACAGAACCAAGGG - Intergenic
943226339 2:185184306-185184328 ACATGGACATAGAGAGTAAAAGG - Intergenic
943887826 2:193245363-193245385 ACTTGAACAATGAGAGCACATGG - Intergenic
948356960 2:237385801-237385823 AAATGGACATTGAGAAGCAATGG - Intronic
948829550 2:240591614-240591636 GGTTGGAGCTTGAGAGCCAAGGG + Intronic
1170682317 20:18537526-18537548 AATTGGACATTGAGAACACATGG + Intronic
1173790321 20:45823977-45823999 ACTTCGACGGTGAGGGCCAACGG - Exonic
1174779355 20:53374192-53374214 AGCTGGACATTGAGTGCCTATGG - Intronic
1175568465 20:59999837-59999859 ACTTGGCCACTGAAAGACAAGGG - Intronic
1182618595 22:31605290-31605312 ACTTGGAAATTGACAGGAAAGGG - Intronic
950026002 3:9820333-9820355 CCTGGGACAGTGGGAGCCAAGGG + Intronic
951541825 3:23789288-23789310 ACTGGGACATAGAGAGGTAAGGG - Intergenic
955024715 3:55156248-55156270 ACTCCAACATTAAGAGCCAAAGG + Intergenic
956232640 3:67034162-67034184 GCTTGTACATTCAGAGCAAAGGG + Intergenic
956346668 3:68287087-68287109 ACTTGGACATGCAGAGCCCCAGG - Intronic
957550258 3:81695056-81695078 AGTTGGACATTAAAAGCAAAAGG - Intronic
958072738 3:88635567-88635589 ACTTGAACATTGAGAACACATGG - Intergenic
958869703 3:99543390-99543412 ACAAGGACATTGAGTGCCAGAGG - Intergenic
959130215 3:102345879-102345901 ACTTGGATATTGTGAGCCTAGGG + Intronic
960414233 3:117364651-117364673 AGTTGGACATTGAGAACACATGG + Intergenic
962365582 3:134777209-134777231 AATTGGAGAGTGAGAACCAAAGG - Intronic
962648399 3:137463292-137463314 ACATGTACATTGATAGGCAAGGG - Intergenic
963564015 3:146904836-146904858 AATTAGACATTGAGAAACAAAGG - Intergenic
965372766 3:167884927-167884949 AATTGGACATGGAGAACTAAGGG - Intergenic
966037765 3:175441121-175441143 ACCTGGATATGGAGAGCCAATGG - Intronic
969289714 4:6230876-6230898 ACTTTTACATTGAGACCCACAGG + Intergenic
970568113 4:17352330-17352352 CCTTTCACATTGAGAGCCACTGG - Intergenic
974150845 4:58007463-58007485 ACTTGAACAATGAGAGCACATGG - Intergenic
975191166 4:71464301-71464323 ATTTAGACATTGAGATTCAAGGG - Intronic
975357340 4:73423618-73423640 ACTTGTACATTTATAGACAAAGG - Intergenic
976065357 4:81181035-81181057 ACTTGAACATTGAGAACACATGG - Intronic
976905873 4:90235207-90235229 CCTGGGACATGGAGAGCCCAAGG - Intronic
977668089 4:99663887-99663909 AGCTGGAAATTTAGAGCCAAGGG - Intergenic
978766839 4:112413335-112413357 ACATGGAAATTGAGATCAAATGG + Intronic
978837012 4:113163281-113163303 ACATGGACACTGAGTGCAAATGG - Intronic
979488862 4:121301008-121301030 ACTTGAACCTAGAGAACCAAAGG - Intergenic
986404885 5:7415944-7415966 ATGGGGACATTGAGAGCCAGGGG + Intronic
987027120 5:13938748-13938770 AGGTTGACATTGACAGCCAAAGG - Intronic
988615484 5:32770932-32770954 ACTTGGACTTTGAGGTTCAAGGG + Intronic
993390066 5:87309075-87309097 ACTGGGAAACTGAGAGCCAGTGG - Intronic
993623095 5:90191026-90191048 AGCTGTACGTTGAGAGCCAAGGG - Intergenic
994323483 5:98421367-98421389 ATTTGGAGATTGAGGGCCCAAGG - Intergenic
999564900 5:152847896-152847918 AGTTGAACAGTGAGAGCCCATGG - Intergenic
1001049285 5:168401472-168401494 GCTTGGAGATAGACAGCCAAAGG - Intronic
1001484037 5:172106868-172106890 TCTTGGACATTCAGGGTCAAGGG + Intronic
1004890432 6:20095893-20095915 ACTAGGAAATAGAGAGCCATAGG + Intergenic
1004918509 6:20354781-20354803 ACTTGGACTTTGATTACCAATGG + Intergenic
1006897362 6:37479604-37479626 GCTGGGACCTTGAGTGCCAAGGG - Intronic
1008963788 6:57293776-57293798 AATTGGACAATGAGAACAAATGG + Intergenic
1010693122 6:78934034-78934056 ACTTGAACATTTAGAGGCCACGG + Intronic
1011375662 6:86683412-86683434 AATTGGGCATTGAGAGCAAGGGG + Intergenic
1011865668 6:91823721-91823743 ACTTAGACAGTGAGAGCACAAGG - Intergenic
1011973965 6:93268690-93268712 ACTTGGACTCTGACAGCAAATGG + Intronic
1012694651 6:102363508-102363530 ACATGGAGGTTGAGAGCCATGGG + Intergenic
1014970160 6:127804140-127804162 ACTTGAACATTAAGAGTTAAGGG + Intronic
1015837188 6:137432980-137433002 ACTTGGACAATGATTGGCAATGG + Intergenic
1017044522 6:150334667-150334689 ATTTTCACATTGAAAGCCAAAGG + Intergenic
1017991761 6:159495045-159495067 AGCTTTACATTGAGAGCCAAGGG - Intergenic
1020369703 7:7418360-7418382 ATTTGGACATTGATATCCACTGG - Intronic
1020986568 7:15142295-15142317 ACTTGGACCTTGAAAGATAATGG - Intergenic
1021205391 7:17773785-17773807 TCTAGGACATTGAGAGCACAAGG - Intergenic
1021592876 7:22283640-22283662 ATTTGGATATTGAGAGTCATGGG - Intronic
1023012906 7:35939432-35939454 ACTTGGCAAGTGAGGGCCAAAGG + Intergenic
1024078226 7:45834421-45834443 ACTTGGCAAGTGAGGGCCAAAGG - Intergenic
1026012554 7:66648096-66648118 ATTTGTAGATTGAGATCCAAAGG + Intronic
1026510362 7:71022287-71022309 ACCTGGACATTGGCAGCCGAAGG - Intergenic
1031423319 7:121575662-121575684 ACTTAGAAACTTAGAGCCAATGG - Intergenic
1032375913 7:131417546-131417568 ACGTGGACATTGAGGTCGAAAGG + Intronic
1032882271 7:136102519-136102541 GCATGGACATGGAAAGCCAAGGG - Intergenic
1034768811 7:153751984-153752006 ACTTGGACTTTGGGATCCTAAGG + Intergenic
1035691998 8:1566024-1566046 ACTTGAAAATTGACAGCCATGGG - Intronic
1044699699 8:94954594-94954616 ATTTGAGCATTGAGAACCAAAGG + Intronic
1046928578 8:119820742-119820764 ACTTGGGAATTGAGAACAAAGGG - Intronic
1048157141 8:131967458-131967480 ACAGGGAGATTGAGAGCCACAGG + Intronic
1048839642 8:138553727-138553749 ACTAGGAAATTGGAAGCCAAAGG + Intergenic
1050634655 9:7598446-7598468 TCTAGGATATTGAGAGCAAATGG - Intergenic
1050981153 9:12017779-12017801 ACTTGGGCTTTGAGAGTCACAGG - Intergenic
1050986693 9:12091758-12091780 ACTTGGGCAGTGGGAGCCCAAGG + Intergenic
1051241548 9:15062143-15062165 AGTTGAACAATGAGAGCCCATGG - Intergenic
1055820335 9:80254319-80254341 ACTTGGTCATTGGGAGCCAAGGG - Intergenic
1058376968 9:104333834-104333856 AATTGGGAATTGAGAGCCATGGG - Intergenic
1058726028 9:107804983-107805005 ACTTGGACTTTGGGAGGCCAAGG + Intergenic
1185767591 X:2738212-2738234 AGGTGGACATGGAGAGCCACCGG + Exonic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1188598790 X:31935022-31935044 GCTTGGCCATGGAAAGCCAAAGG + Intronic
1190417015 X:50190219-50190241 ACTGGGACATTGGGCCCCAAAGG + Intergenic
1190530201 X:51367586-51367608 ACTTGAACATTGAGAACATACGG + Intergenic
1190534406 X:51411475-51411497 ACTTAGACATGGAGACACAAAGG - Intergenic
1190654860 X:52602519-52602541 AATTGAACATTGAGAACCCACGG + Intergenic
1192314473 X:70041323-70041345 ACTGGGGCCTTGAGAGCCAGTGG - Exonic
1192763342 X:74118975-74118997 ACTTAGGCAGTGAGAGCCTAAGG - Intergenic
1192975596 X:76280740-76280762 AGTTGAACAATGAGAGCAAATGG - Intergenic
1194022161 X:88704273-88704295 AGTTGAACATTGAGAGCACATGG + Intergenic
1196968436 X:121083641-121083663 CCTTGGAAATTGAGAGCAATTGG - Intergenic
1197737967 X:129866621-129866643 AGTTGAACATTGAGAACAAATGG + Intergenic
1198297293 X:135300369-135300391 ACTTGGAAATTGACAGCTCAGGG + Intronic