ID: 902697511

View in Genome Browser
Species Human (GRCh38)
Location 1:18150294-18150316
Sequence GGCCCAGGCCTTAGAGCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902697511_902697519 14 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697519 1:18150331-18150353 GGATAGCACCTTCCTTACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 55
902697511_902697518 11 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697518 1:18150328-18150350 TGGGGATAGCACCTTCCTTACGG 0: 1
1: 0
2: 0
3: 16
4: 115
902697511_902697516 -7 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697516 1:18150310-18150332 CTGGGCCTCTCTGGAAAATGGGG 0: 1
1: 0
2: 7
3: 23
4: 296
902697511_902697523 22 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
902697511_902697525 27 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697525 1:18150344-18150366 CTTACGGAGGCTGGGAGGATTGG 0: 1
1: 0
2: 1
3: 16
4: 272
902697511_902697520 18 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697520 1:18150335-18150357 AGCACCTTCCTTACGGAGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 87
902697511_902697515 -8 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697515 1:18150309-18150331 CCTGGGCCTCTCTGGAAAATGGG 0: 1
1: 0
2: 1
3: 34
4: 259
902697511_902697513 -9 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697513 1:18150308-18150330 GCCTGGGCCTCTCTGGAAAATGG 0: 1
1: 0
2: 2
3: 23
4: 271
902697511_902697521 19 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697521 1:18150336-18150358 GCACCTTCCTTACGGAGGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902697511 Original CRISPR GGCCCAGGCCTTAGAGCACG TGG (reversed) Intronic
900356693 1:2268364-2268386 GTCCCAGGCCACAGAGCACCAGG - Intronic
901453797 1:9352050-9352072 AGCCCAGGCCTTGGACCACATGG - Intronic
901678171 1:10898732-10898754 GGCCCAGGGCTGAGAGGGCGGGG + Intergenic
902697511 1:18150294-18150316 GGCCCAGGCCTTAGAGCACGTGG - Intronic
906126203 1:43428398-43428420 GGCCCAGGGCTGAGAGGACCAGG - Exonic
906530260 1:46519925-46519947 GGCCAAGGCCTAAGAGAAGGGGG - Intergenic
907854135 1:58284566-58284588 GGCCCAGGCCTCTGACCACAGGG + Intronic
915091459 1:153429076-153429098 GGCCCAGGGCTGGGAGCAAGGGG + Intergenic
916265001 1:162881925-162881947 AGCCCAGGCCTTAGGTCACAGGG - Intergenic
919806017 1:201381448-201381470 GGTCCAGGCCTCAGAGAAGGGGG + Exonic
921409171 1:214816042-214816064 GGATCAGGTCTTAGAGCATGGGG - Intergenic
922222576 1:223619541-223619563 GGCACAGGCCCTAGAGGCCGTGG + Intronic
1062835190 10:630881-630903 GGCCCGGCCCTTGGAGCACAGGG + Intronic
1063631206 10:7735189-7735211 GGCCCAGGGCTGGGAGCAAGAGG - Intronic
1069844781 10:71363281-71363303 GACCCAGGCCATAGACCACCAGG - Exonic
1072071669 10:91923970-91923992 GGCCCAGGCCGCGGAGCACAGGG - Exonic
1074921402 10:118017628-118017650 GGCCCAATCCGTAGAGCAGGAGG + Intronic
1076632273 10:131858244-131858266 GTCCCAGGCTTTAGAGATCGTGG - Intergenic
1087443918 11:98221950-98221972 GGCCCAGGCGGTGGATCACGAGG - Intergenic
1089642885 11:119859318-119859340 GGCCCAGGCCTTAGAAGACCAGG + Intergenic
1089698257 11:120228896-120228918 GCCCAAGGCCTCAGAGCAGGCGG + Exonic
1092524683 12:9302458-9302480 GCCCCAGGCCTCAGAGCCAGCGG - Intergenic
1092542580 12:9429354-9429376 GCCCCAGGCCTCAGAGCCAGCGG + Intergenic
1094510435 12:31093080-31093102 GCCCCAGGCCTCAGAGCCAGCGG - Intronic
1096616258 12:52834963-52834985 GGCCCAGGCCCTTGATCAGGAGG + Intergenic
1103447145 12:121001781-121001803 GGCTCAGGCGTTAGAGCCCCAGG - Exonic
1103817584 12:123671225-123671247 AGCCCATGCCTTAGACCTCGCGG - Exonic
1103947221 12:124533137-124533159 GGCCCAGGGCTTAGGGCCCAAGG + Intronic
1104224015 12:126813416-126813438 GGCCCAGGGCTTTGGGCAGGGGG + Intergenic
1104719430 12:131036829-131036851 GCCCCAGGCCTTACTGCATGGGG + Intronic
1104719482 12:131037169-131037191 GTCCCAGGCCTTACTGCATGGGG + Intronic
1111144099 13:84157811-84157833 GACCCAGGACTAAGAGCAGGAGG - Intergenic
1111951365 13:94711746-94711768 CGCCCAGGCCGTAGGGCACCGGG + Exonic
1113505872 13:110815466-110815488 GCCCAAAGCCTTAGAGCACCTGG - Intergenic
1115391673 14:32861115-32861137 GGCCGAGGCCTGAGAGCCCCTGG - Intergenic
1115398263 14:32933394-32933416 GGCCCAGGCCTTGGCGCGCAGGG + Intergenic
1118509413 14:66454650-66454672 AGCCCAGACATTAGAGGACGTGG + Intergenic
1121293293 14:92794772-92794794 GGCCCAGTCCGTAGAGCCCTGGG - Intronic
1122356727 14:101127099-101127121 GGCCCAGGCCTGAGGGCTGGGGG - Intergenic
1122759066 14:104007412-104007434 AGCACAGGCCTGAGAGCAAGCGG - Intronic
1122827160 14:104375843-104375865 GGCCCAGGGGTCAGAGCAGGCGG + Intergenic
1127963226 15:63905679-63905701 TTCCCAGGGCTTAGAGAACGTGG + Intergenic
1129868846 15:78928330-78928352 GGCCGAGGCGGTAGATCACGAGG + Intronic
1130256907 15:82330012-82330034 GCCACAGGCCTTGGAGCACTGGG - Intergenic
1132805386 16:1772888-1772910 GGCCCAGGCCGAAGAGCGGGAGG + Exonic
1132931867 16:2462755-2462777 GGCCCAGACCTCAGTGCAGGTGG - Intronic
1136393752 16:29981779-29981801 GGCCCAGGCGTTAGGCCATGGGG + Intronic
1136515425 16:30765309-30765331 GGCAGAGGCCTTAGAGCAGGTGG + Exonic
1137586010 16:49664405-49664427 GGCCCAGGGCTCAGGCCACGCGG + Intronic
1138093448 16:54194549-54194571 GACTCGGGGCTTAGAGCACGTGG - Intergenic
1138950271 16:61904477-61904499 GGTCCAGGCCTCAGGGCAGGAGG + Intronic
1139377566 16:66509730-66509752 GGCCTTGTCCTTAGAGCACTGGG - Exonic
1140037991 16:71385532-71385554 GGCCCAGGCTTTAGAGCTCTGGG + Intronic
1140046193 16:71441871-71441893 GGCCCCAGCCTGGGAGCACGTGG + Intergenic
1140715502 16:77722455-77722477 GGGGCGGGGCTTAGAGCACGAGG - Intergenic
1140903425 16:79391170-79391192 GCCCAAGGTCTTAGAGCACTGGG - Intergenic
1142151596 16:88514841-88514863 GGCCCAGGCCTTGGGGTACTGGG + Intronic
1142696690 17:1637922-1637944 GGCCCAGGGCATAGAGCCCAGGG - Intronic
1143093676 17:4465069-4465091 GGACCAGGCTTGAGAGCAAGAGG + Intronic
1144450177 17:15370589-15370611 GAACCAGGCCTCAGAGCAGGAGG - Intergenic
1146685947 17:34841767-34841789 GGCCCAGGCCAGAGAGAAGGAGG + Intergenic
1148029262 17:44608543-44608565 GGCCCAGGCCTTGGGGGAGGGGG - Intergenic
1148456598 17:47814599-47814621 GGCCCAGGGCTCAGAGGAGGAGG - Exonic
1148896080 17:50839995-50840017 GGCCCCGGCCTGAGATCACCTGG + Exonic
1149603632 17:57909673-57909695 GGCCCAGGCCTCAGAGGACCAGG + Intronic
1150590533 17:66558485-66558507 GGCCGAGGGCCTAGAGCACCCGG + Intronic
1150608500 17:66714358-66714380 GGCACAGGCCTGAGGGCACAAGG - Intronic
1152599065 17:81252429-81252451 GGCCCAGGCCTTGGAGGAGGCGG - Exonic
1152655983 17:81519421-81519443 GCCCCAGGCCTCCGAGCTCGTGG - Intronic
1152809465 17:82374693-82374715 AGTCCAGGCCGAAGAGCACGCGG - Exonic
1156290655 18:35746840-35746862 GGCCCAGTCCTTGGAGCAACAGG + Intergenic
1160566544 18:79789716-79789738 GGACCAGGCCTTAGAGCCACGGG + Intergenic
1161064718 19:2231990-2232012 GGCCCAGGGCTCAGAACAGGAGG - Exonic
1161485766 19:4534973-4534995 GGACCAGGCCTCAGAGGACGCGG - Intronic
1162909988 19:13843264-13843286 GGCGCAGGCCTTAGACCAACAGG - Intergenic
1163151654 19:15418638-15418660 GGTCCGGGCCTCAGCGCACGAGG - Intronic
1165079348 19:33298690-33298712 GCCCCAGGCCTCGGGGCACGCGG + Intergenic
1165884872 19:39070925-39070947 GGCCCACGCCTGAGAGCCTGTGG + Intergenic
1166121879 19:40691330-40691352 GCCACAGCCCTTAGAGCAGGTGG + Intergenic
1166857167 19:45788169-45788191 GGCCCAGGCATTGGAGCCTGAGG - Intronic
1166935709 19:46331162-46331184 GGCCCAGAGCTCAGAGGACGAGG + Exonic
1167011233 19:46809628-46809650 GGGCCAGACCATAGAGCACATGG + Intergenic
1167299518 19:48670843-48670865 GGCACAGGCCTGAGGGCAGGAGG + Exonic
1168351663 19:55679591-55679613 GGCCCAGGTCTAAGCGCATGAGG - Intronic
927137034 2:20104745-20104767 TGCCCAGTCCTCAGAGCACTGGG + Intergenic
928750245 2:34462115-34462137 GGCCTAGACTTTAGAGCATGAGG - Intergenic
932463316 2:71897289-71897311 GGCCCTGGCCATGCAGCACGTGG + Intergenic
934935446 2:98461960-98461982 GGCCCAGACCTCAGAGCAAGGGG - Intronic
938968910 2:136414579-136414601 GGCCCAGGCCTTACTTCACCAGG - Intergenic
944346638 2:198673895-198673917 GCCCCAGGCCTTATGGCACCTGG + Intergenic
946964863 2:225027032-225027054 GGCCCCGTACATAGAGCACGTGG + Intronic
947230295 2:227877818-227877840 GGCCCAGGCCACACAGCAGGAGG - Intronic
947903712 2:233743989-233744011 GGCCCAGGTCTCCGAGCACTCGG - Intronic
1174258768 20:49278182-49278204 GGCCCAGGGTGGAGAGCACGAGG + Exonic
1175736530 20:61391126-61391148 GCCTCAGGCCTCAGAGCACTTGG + Intronic
1176309603 21:5142660-5142682 GGCCCAGGCCTGTGCACACGGGG + Exonic
1179731055 21:43367696-43367718 GGCCAGGGCCTCAGAGCACAGGG + Intergenic
1179847457 21:44119373-44119395 GGCCCAGGCCTGTGCACACGGGG - Exonic
1180189426 21:46155389-46155411 GGCCCAGGCCATGGAGGAGGTGG - Intronic
1180848175 22:18995611-18995633 GGCCCAGGGCTGTGAGCACTCGG + Intergenic
1182419850 22:30243644-30243666 GGCCCAGGCCTTCTAGCAGGAGG - Exonic
1183546431 22:38456530-38456552 GGCCCAGGCCTGACAGCTTGGGG - Intergenic
1183955858 22:41380565-41380587 GGCCCAGCCCTTCTAGCAGGAGG - Intronic
1184563097 22:45274789-45274811 GGGCCAGGCCTTGGAGAATGGGG + Intergenic
1185058350 22:48592719-48592741 GGCTCAGGCCTCTGAGCAGGAGG - Intronic
1185330432 22:50249808-50249830 GGCCCAGGCCACACAGCAAGGGG - Intronic
949649816 3:6144130-6144152 GGCCCTGGCCTCAGGGCACCAGG + Intergenic
950478337 3:13228047-13228069 CTCCCAGGCCTGAGAGCAGGAGG - Intergenic
956746794 3:72316961-72316983 GCCTCAGGCCATAAAGCACGGGG + Intergenic
957051876 3:75417801-75417823 GGCACAGCCCTCAGAGCACATGG - Intergenic
960592827 3:119381750-119381772 GGCCCAGGCGGGCGAGCACGAGG + Intronic
961194060 3:124986495-124986517 GGCCCAGACCTCAGAGAAAGAGG + Intronic
961786364 3:129349606-129349628 CTCCCAGGCCTGAGAGCAGGAGG + Intergenic
967294562 3:187952510-187952532 GGCCTAGGCCTTACAGTACTAGG - Intergenic
968799359 4:2732130-2732152 GGCCCAGGCCTCCGAGGCCGCGG - Exonic
968968287 4:3780600-3780622 GGGCCAGCCCTTAGGGCAGGTGG - Intergenic
971473300 4:27050018-27050040 GGCCCACGCCATGGAACACGGGG + Intergenic
973288482 4:48446160-48446182 CGCCCAGGCCATAGAGCAGTAGG + Intergenic
978903240 4:113978675-113978697 GGGCCAGGCCTTAGAAGAGGAGG - Exonic
979468650 4:121070967-121070989 GGCCCAGGCGTGAGAGCTCCCGG - Intronic
985553414 5:544472-544494 GGGCCAGGCCTTTGCGCACCAGG + Intergenic
986562550 5:9076992-9077014 GGCACAGGCCTTTGAACATGAGG + Intronic
987371720 5:17199624-17199646 GGCCCAGGACTTAGAGGCAGGGG - Intronic
990866043 5:60381095-60381117 GCCTCAGGCCTTGGAGCATGTGG + Intronic
994210725 5:97085257-97085279 GGACCGGGCCTTGGAGCAGGGGG + Intergenic
999314839 5:150576661-150576683 GGCCCTGGCCTTGGAGCACAGGG - Intergenic
1002306242 5:178285737-178285759 GGCCCAGGCCCTTCAGCACGAGG + Intronic
1002541005 5:179906930-179906952 GGCGCAGGCCCTGGAGCATGAGG + Intronic
1004426041 6:15507842-15507864 GGCCCAGGCCTTGGCGAAAGTGG + Intronic
1004635670 6:17465440-17465462 GGTCCAGGCCTTATTGCACATGG - Intronic
1006027186 6:31154639-31154661 GGCCCAGGCCATGGAGCTAGAGG - Exonic
1015116597 6:129656406-129656428 GGCCCAGGCGGTGGATCACGAGG + Intronic
1015970904 6:138741750-138741772 GGTCCAGGCCGTAGAGAATGGGG - Intergenic
1018919415 6:168161105-168161127 GGCCAAGACCTTGGAGCACCCGG + Intergenic
1019395825 7:817028-817050 GGCCGAGGCCTGAGAACGCGGGG - Intronic
1019604658 7:1902435-1902457 GGCCCAGGCCTTTCAGAAGGAGG + Intronic
1019989735 7:4682918-4682940 GGCCCGGGCCTCAGAGATCGAGG - Intronic
1025840768 7:65143714-65143736 GGCCCAGGCCTTGGTGCGGGTGG - Intergenic
1027190464 7:75993353-75993375 GGGGCTGGCCTTAGAGCAGGAGG - Intronic
1027319595 7:77003567-77003589 GGCCCTGGCCTTAGGGGACCTGG - Intergenic
1030148779 7:106382253-106382275 GGCCCAGGCCTGGGAGGAGGAGG + Intergenic
1032096464 7:128940689-128940711 TGCCCTGGCCTCAGAACACGCGG - Intronic
1032636040 7:133710261-133710283 GACCCAGGCCTTTGAGCAAGAGG - Intronic
1033273079 7:139950394-139950416 GCCACAGGGCTTAGAGCACTGGG - Intronic
1033463395 7:141568153-141568175 GGCTCAGACCTTAGACCACCTGG - Intronic
1034535487 7:151723480-151723502 GGCCCACGCCCTAGGTCACGCGG + Intronic
1034627688 7:152506033-152506055 GGCCCAAGCCTTAGATAAGGAGG + Intergenic
1034970380 7:155415404-155415426 CGACCAGGCCTTAGAGGACCGGG + Intergenic
1036649973 8:10635956-10635978 GGCACAGGCCCGAGAGCACAGGG + Intronic
1039952335 8:42181923-42181945 GGCCCAGCCCTTACAGCAGGAGG + Exonic
1041815228 8:61962967-61962989 GGCCCAGGCCACAAAGCAAGAGG + Intergenic
1045676607 8:104614761-104614783 GGACCAGGCCGTACAGCAGGAGG - Intronic
1049106260 8:140615391-140615413 GGCCCGGGGCCTAGAGCAGGTGG - Intronic
1049670896 8:143869425-143869447 GGCCCAGGCCTGTGGGCAGGAGG + Exonic
1060524906 9:124315083-124315105 GGCCAAGGCCTGAGAACACAGGG - Intronic
1061009087 9:127944724-127944746 GGGCCAGCCCTTGGAGCAGGTGG + Intronic
1062391915 9:136337278-136337300 GCCCCAGGTCTCAGAGCTCGAGG + Intronic
1062499497 9:136846199-136846221 CGGCCAGGCCTCAGAGCCCGCGG + Exonic
1186451547 X:9677929-9677951 GATCCAGGCCTTGGAGCACCTGG + Intronic
1190316727 X:49156448-49156470 GGCCCAGGCCTGCGCGCAAGAGG + Intergenic
1200078961 X:153566166-153566188 GGCCCAGGCCTTGCAGAAGGAGG - Intronic
1200156982 X:153982077-153982099 GGGGCAGGCCTTCGTGCACGTGG + Exonic