ID: 902697517

View in Genome Browser
Species Human (GRCh38)
Location 1:18150315-18150337
Sequence GCTATCCCCATTTTCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 2, 2: 13, 3: 104, 4: 704}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902697517_902697523 1 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
902697517_902697525 6 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697525 1:18150344-18150366 CTTACGGAGGCTGGGAGGATTGG 0: 1
1: 0
2: 1
3: 16
4: 272
902697517_902697521 -2 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697521 1:18150336-18150358 GCACCTTCCTTACGGAGGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 74
902697517_902697518 -10 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697518 1:18150328-18150350 TGGGGATAGCACCTTCCTTACGG 0: 1
1: 0
2: 0
3: 16
4: 115
902697517_902697520 -3 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697520 1:18150335-18150357 AGCACCTTCCTTACGGAGGCTGG 0: 1
1: 0
2: 1
3: 10
4: 87
902697517_902697519 -7 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697519 1:18150331-18150353 GGATAGCACCTTCCTTACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 55
902697517_902697526 28 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697526 1:18150366-18150388 GAGACAGTTCACTTGTAACAAGG 0: 1
1: 0
2: 1
3: 17
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902697517 Original CRISPR GCTATCCCCATTTTCCAGAG AGG (reversed) Intronic
900336257 1:2165438-2165460 GCTCTCGCCATTTTACAGATGGG - Intronic
901061465 1:6473870-6473892 GCCAACCCCATTTTCCAGAAGGG + Intronic
901687786 1:10953669-10953691 GGTATGCCTATTTTCCAGATGGG + Intronic
902079741 1:13812899-13812921 ACTGTCTCCATTTTACAGAGGGG + Intronic
902150210 1:14436771-14436793 ATTATTCCCATTTTACAGAGAGG + Intergenic
902180442 1:14684384-14684406 TTTATCCCCATTTTGCAGATGGG - Intronic
902302503 1:15512046-15512068 CACATCCCCATTTGCCAGAGGGG + Intronic
902384575 1:16069052-16069074 GTTATGCCCATTTTACAGATAGG + Intronic
902590013 1:17467048-17467070 GTTATTCCCATTTTACAGAAGGG - Intergenic
902596220 1:17511363-17511385 TTTATCCCCATTTTACAGACGGG + Intergenic
902686739 1:18082188-18082210 ATTATCCCCATTTTACAGATGGG - Intergenic
902697517 1:18150315-18150337 GCTATCCCCATTTTCCAGAGAGG - Intronic
902780188 1:18699950-18699972 CCTATTCCCATTTTACAGAAGGG - Intronic
902800764 1:18828593-18828615 ATTATCCCCATTTTCTAGATGGG - Intergenic
902841414 1:19076434-19076456 GTTATCCCCATTTTATAGATGGG - Intronic
903042154 1:20539312-20539334 TCTATCCACCTTTTTCAGAGAGG + Intergenic
903280559 1:22247684-22247706 ACTCTCCCCATTTTACAGACAGG + Intergenic
903285450 1:22274051-22274073 ATTATCCCCATTTTACAGAGGGG - Intergenic
903416550 1:23187399-23187421 ATTATCCCCATTTTGCAGATGGG - Intergenic
903557465 1:24204147-24204169 ACTGCCCCCATTTTACAGAGAGG + Intergenic
903648536 1:24909477-24909499 ACTGTCCCCATTTTGCAGATAGG - Intronic
903722174 1:25413749-25413771 ATTATCCCCATTTTAGAGAGGGG + Intronic
903741832 1:25562866-25562888 GCTGTTCCCATTTTTCAGATGGG - Intronic
903760388 1:25693852-25693874 GTTATCCCCATTGTACAGATGGG - Intronic
904030496 1:27530572-27530594 ATTATCCCCATTTTACAGACAGG - Intergenic
904482438 1:30802398-30802420 ATTACCCCCATTTTACAGAGAGG + Intergenic
904575531 1:31502904-31502926 GTTATCCCCATTTTGCAGATGGG - Intergenic
904827999 1:33288139-33288161 ATTATCCCCATTTTAGAGAGGGG + Intronic
904937628 1:34142745-34142767 ATTATCCCCATCTTGCAGAGGGG - Intronic
905010266 1:34742347-34742369 GCTCTCCCCATGTCCCAGCGAGG + Intronic
905208507 1:36357187-36357209 ACTATCCCCATTTTATAGATGGG + Intronic
905337007 1:37251693-37251715 ATTATACCCATTTTACAGAGGGG - Intergenic
905869047 1:41392492-41392514 ATTATCCCCACTTTACAGAGAGG + Intergenic
905945240 1:41896188-41896210 TTTATTCCCATTTTACAGAGTGG - Intronic
906559789 1:46748081-46748103 GCCATCTCTATTTTCCAGATGGG + Intergenic
907305111 1:53508988-53509010 GCCATCCCCACTTTACAGAGGGG - Intronic
907395692 1:54188249-54188271 GCTGTCCCCATTTTACAAAAGGG - Intronic
907680596 1:56559809-56559831 CTCATCCCCATTTTCCAGATGGG - Intronic
908389050 1:63669015-63669037 AATATCCCCATTTTACAGATGGG + Intergenic
908632889 1:66129709-66129731 TCTTTCCCCATTTTACAGAGAGG - Intronic
911293074 1:96081287-96081309 CCTTTCCCCATTCTCCGGAGTGG + Intergenic
912193446 1:107368415-107368437 GCTTTCCTCATTTTACAGATAGG + Intronic
912252442 1:108025602-108025624 GTTAACCCCATTTTTCAGATGGG - Intergenic
912277081 1:108270500-108270522 GCTATATCCATTTTCCCAAGAGG + Intergenic
912291147 1:108423856-108423878 GCTATATCCATTTTCCCAAGAGG - Intronic
912681429 1:111731660-111731682 GTTATTCCCATTTTAAAGAGTGG - Intronic
913000814 1:114578882-114578904 GCTATCCCCATTTTTTAGCTGGG - Intronic
913139040 1:115922159-115922181 ATTATTCCCATTTTACAGAGAGG - Intergenic
913233424 1:116760935-116760957 CAAAGCCCCATTTTCCAGAGAGG + Intronic
913456682 1:119039109-119039131 ATTATCCCCATTTTACAGATGGG - Intronic
914227769 1:145735676-145735698 AATAGCCCCATTTTCTAGAGTGG - Intronic
914420900 1:147527547-147527569 ACTAGCCCCATTTTACAGATAGG + Intergenic
914801156 1:150963620-150963642 GCTCTCCCCCTTGTCCACAGAGG - Exonic
915604139 1:156940199-156940221 GCACTCACCATCTTCCAGAGCGG + Exonic
915903853 1:159864073-159864095 ATTATCCCCATTTTACAGATGGG + Intronic
916451718 1:164927323-164927345 ATTATCCCCATTTTACAGATGGG - Intergenic
916929521 1:169560823-169560845 GCTATCCCCAGATTTGAGAGTGG - Intronic
917153527 1:171969836-171969858 ACTATCCCCATTTTACATAGAGG + Intronic
917458447 1:175205924-175205946 ACTATCCCCATTTTACAGACTGG + Intergenic
917619294 1:176779689-176779711 ACTATCCCTATTTTCCAGCTAGG + Intronic
917666610 1:177231207-177231229 GTTTTCCCCATTTTACAGATGGG + Intronic
918041279 1:180915517-180915539 TCTATCCCCATTTTATAGACGGG - Intronic
918184063 1:182111785-182111807 ACTATCCTCATTTTACACAGTGG + Intergenic
918311821 1:183290521-183290543 GTTATTCCCATTTTACAGATGGG - Intronic
918327818 1:183427156-183427178 GCGCTCCTCATTTCCCAGAGGGG - Intergenic
919574478 1:199290510-199290532 ATCATCCCCATTTTCCAGATGGG - Intergenic
919765753 1:201126418-201126440 TCTATTCCCATTTTACAGATGGG + Intronic
919774718 1:201186934-201186956 ACTAACCCCATTTTACAGAAGGG - Intergenic
919861751 1:201743480-201743502 GCTATACCCATTTTATAGAGAGG - Intronic
919960063 1:202458037-202458059 ACTCTCCCCATTCCCCAGAGAGG - Intronic
919960095 1:202458320-202458342 ACTCTCCCCATTCCCCAGAGAGG - Intronic
920278678 1:204827471-204827493 TCTATGCCCATTTTACAGATGGG + Intergenic
920381621 1:205537800-205537822 ACTATCTCCGTTTTACAGAGAGG - Intergenic
921129843 1:212210333-212210355 GTTATCCTCATTTTACAGATGGG + Intergenic
921622537 1:217341770-217341792 CTTATCCCCATTTCACAGAGAGG + Intergenic
922433399 1:225579070-225579092 AATATCCCCATTTTACAGATAGG + Intronic
922950315 1:229553605-229553627 CTTATCCTCATTTTTCAGAGAGG - Intronic
923099137 1:230798430-230798452 AGTATCCCCATTTTGCAGGGTGG + Intronic
923132886 1:231092561-231092583 GCTAGTCCCATTTTACAGATGGG - Intergenic
923614296 1:235524116-235524138 GCTATCCCCATTTTACAATGAGG - Intergenic
923658191 1:235936662-235936684 GTCATCCCCATTTTACAGATGGG + Intergenic
924372196 1:243362500-243362522 TCTATCCTCATTTTACAAAGAGG - Intronic
1063686124 10:8238571-8238593 ATTATCCCCATTTTACAGAGGGG - Intergenic
1063936665 10:11085578-11085600 GCTTTCCCCAGTTTACAGATGGG + Intronic
1063990783 10:11559865-11559887 GGTATCCCAATTTTGCAGATAGG - Intronic
1064046441 10:12020737-12020759 GTTATGCCCATTTTACAGATGGG + Intronic
1065346373 10:24751607-24751629 GCTATCCCCATGTTGCAGATTGG - Intergenic
1065874936 10:29989376-29989398 TGTATCCCCATTTTACAGATAGG + Intergenic
1065942125 10:30574557-30574579 GTTATGCCCAGATTCCAGAGAGG + Intergenic
1065972547 10:30817062-30817084 ACTACTCCCATTTTACAGAGAGG + Intergenic
1066345032 10:34576299-34576321 GCCATCCCGACCTTCCAGAGGGG + Intronic
1067086067 10:43238803-43238825 GCCATCCCCATGAGCCAGAGAGG + Intronic
1067288681 10:44925750-44925772 GTTATCCCCACTTTACATAGAGG - Intronic
1067562026 10:47310808-47310830 GTTATTCCCATTTTGCAGATGGG - Intronic
1067656276 10:48194338-48194360 AGCATCCCCATTTTCCAGCGTGG - Intronic
1067689398 10:48491773-48491795 ACTATTCCCATTTTAAAGAGAGG + Intronic
1068883677 10:62076675-62076697 TTTATACACATTTTCCAGAGGGG - Intronic
1069045961 10:63743214-63743236 TCTATCCCCATCAACCAGAGTGG + Intergenic
1069674614 10:70238814-70238836 GCGTTCCCCATTTCCCAGATGGG + Intergenic
1069674700 10:70239118-70239140 GCACTCCCCATTTCCCAGATGGG + Intergenic
1069674752 10:70239306-70239328 GCGCTCCCCATTTCCCAGATGGG + Intergenic
1069674846 10:70239651-70239673 GCGTTCCCCATTTCCCAGATGGG + Intergenic
1069674910 10:70239881-70239903 GCGCTCCCCATTTCCCAGATGGG + Intergenic
1069675002 10:70240228-70240250 GCGCTCCCCATTTCCCAGATGGG + Intergenic
1069797487 10:71062683-71062705 GCTACCCCCATTCTTCAGATGGG + Intergenic
1069879432 10:71582613-71582635 GTTATCTCCATTTTACAGATTGG - Intronic
1070114649 10:73516841-73516863 TCTATCCCCACCCTCCAGAGAGG + Exonic
1070560558 10:77563595-77563617 GCTATTCCCAGTCTCCATAGAGG + Intronic
1070711239 10:78684680-78684702 ACCACCCCCATTATCCAGAGAGG - Intergenic
1070805348 10:79267539-79267561 ATTATCCCCATTTTGCAGAAGGG + Intronic
1070920954 10:80186134-80186156 AATATCCCCATTTTACAGATGGG - Intronic
1072286588 10:93921469-93921491 GTTATCCTCGTTTTACAGAGGGG + Intronic
1072628629 10:97130699-97130721 GCTATCCTTATTTTACAGATGGG - Intronic
1073346330 10:102785576-102785598 GCAATCCCCACTTTTAAGAGGGG + Intronic
1073551709 10:104408317-104408339 ATTATCCCCATTTTACAGATGGG - Intronic
1074086614 10:110212691-110212713 GTTATCCCCATTTTGCAAAAAGG - Intronic
1074206635 10:111288450-111288472 GTTCTTCCCATTTTACAGAGAGG - Intergenic
1074447833 10:113534792-113534814 CATATCCCCATTTTACAGATGGG - Intergenic
1074540800 10:114363861-114363883 ATTATCCCCATTTTACAGATGGG + Intronic
1074850560 10:117436215-117436237 GCCATCCTCATTTTCTGGAGAGG + Intergenic
1075210735 10:120488914-120488936 GTTATCTCCAATTTCCAGAGAGG - Intronic
1075343493 10:121665312-121665334 ATTATCCCCATTTTACAGATGGG - Intergenic
1075502144 10:122984876-122984898 ACTATCCCCATTTTATAGATGGG + Intronic
1075921647 10:126218363-126218385 CTTATGCCCATTTTGCAGAGGGG + Intronic
1077424517 11:2468016-2468038 GTTATCCCTATTTTACAGATGGG - Intronic
1078261815 11:9716519-9716541 GTTATCCCCATTTTACAGATGGG - Intronic
1078595703 11:12684622-12684644 ATCATCCCCATTTTCCAGATGGG - Intronic
1079089157 11:17468749-17468771 AATATCCCCATTTTCCAGTGTGG - Intronic
1079293151 11:19206925-19206947 GCTTTCCTCACTTTCCAGTGTGG - Intronic
1079302032 11:19286616-19286638 GTTACACCCATTTTACAGAGAGG + Intergenic
1079946416 11:26747765-26747787 GCAATACCTATTTTTCAGAGTGG - Intergenic
1080109004 11:28544530-28544552 CATTTCCCCATTTTCCTGAGAGG + Intergenic
1080649730 11:34212490-34212512 ACTAACCCCATTTGCCAGCGAGG + Intronic
1081607378 11:44535799-44535821 TCTGTCCCCATTTTACAGATGGG - Intergenic
1081800717 11:45857287-45857309 GCTATCCCGATTTACAGGAGAGG + Intronic
1082128907 11:48463682-48463704 CTTATCCCCATTTACCAAAGAGG - Intergenic
1082248495 11:49953698-49953720 CTTATCCCCATTTACCAAAGAGG + Intergenic
1082562451 11:54634658-54634680 CTTATCCCCATTTACCAAAGAGG - Intergenic
1082809777 11:57472637-57472659 GTTATCCCCATTTCACAGATGGG - Intronic
1083149465 11:60782973-60782995 ATTATCCCCATTTTATAGAGGGG + Intergenic
1083171765 11:60927511-60927533 GTGCTCCCCATATTCCAGAGGGG + Intronic
1083237889 11:61363334-61363356 ATTATCCCCATTTTACACAGAGG - Intronic
1083268772 11:61560091-61560113 GTTGTCCCCATTTTACAGATGGG + Intronic
1083786613 11:64952545-64952567 GTTATTCCCATTTTACAGACGGG + Intronic
1083842294 11:65311394-65311416 ACGATCCCCATTTTACAGATGGG - Intergenic
1084000048 11:66291344-66291366 TTTATCCCCATTTTTCAGATGGG + Intergenic
1084291211 11:68169616-68169638 GTTATCCCCATTTTACAGATGGG + Intronic
1084458727 11:69284526-69284548 ATTATCCCAATTTTCCAGATGGG - Intergenic
1084591030 11:70090467-70090489 GCTATCTCCATTTTACAAATGGG - Intronic
1084615658 11:70234183-70234205 CCTATCCCCATTTTACAGATAGG - Intergenic
1084888076 11:72223698-72223720 AGGATCCCCATTTTCCAGAGCGG + Intronic
1084950793 11:72664331-72664353 GCTAGCCCTATTTTGTAGAGGGG - Intronic
1085120852 11:73966472-73966494 ACTGTCCCCATTTTACAGAGTGG + Intronic
1085197048 11:74679132-74679154 GGTCTCCCCAATTTCCAGATGGG + Intergenic
1085473082 11:76770508-76770530 GTTATCCCCATTTTACAGAGAGG - Intergenic
1085560572 11:77469518-77469540 ACTATCCCCATTTTACAGTTGGG + Intronic
1085640159 11:78188440-78188462 GCCATCCCCATTTCACAGATGGG + Intronic
1085793366 11:79515462-79515484 TCTATCCCCATTTTACAGAGGGG - Intergenic
1085803028 11:79608956-79608978 GTTAGCCCCATTTTACAGATGGG - Intergenic
1086021339 11:82233752-82233774 ATTATCCCTATTTTCCAGATTGG + Intergenic
1086259851 11:84925753-84925775 GTTATCCCCATTTTACAAATGGG - Intronic
1086400135 11:86454600-86454622 GCCATCCTCATTTTACAGATTGG + Intronic
1086879893 11:92140797-92140819 ATTAGCCCCATTTTACAGAGGGG + Intergenic
1087171724 11:95056132-95056154 GCTATCTCCATTTTACATTGAGG - Intergenic
1089023371 11:115241537-115241559 ACTATCCCCATTCTTCAGATGGG - Intronic
1089388778 11:118085875-118085897 GCTTTCCCTCTGTTCCAGAGTGG - Intronic
1089709148 11:120302466-120302488 GCTATCCCCTCTCCCCAGAGGGG - Intronic
1090413864 11:126527535-126527557 TTTATCCCCATTTTCCAGATGGG + Intronic
1090415534 11:126537707-126537729 GTCATCCCCATTTTTCAGATAGG - Intronic
1090507867 11:127338758-127338780 TCCATCACCATTTTCCAGACAGG + Intergenic
1091533535 12:1383911-1383933 GTTATCCTCATTTTACAGAGAGG + Intronic
1094155656 12:27334316-27334338 GTTATCTCCATTTTACAGATGGG - Intronic
1094227915 12:28067259-28067281 GCAGTCCCCCTTTTCCAGACTGG + Intergenic
1096012633 12:48233857-48233879 ACTATCTCCATTTTACAGATGGG + Intergenic
1096459126 12:51812369-51812391 ATTATCCCCATTTTACAGATGGG - Exonic
1096622519 12:52873486-52873508 GCTATCCCCATTTTACAGATAGG + Intergenic
1097089602 12:56494668-56494690 GCCATCCCCACTTCCCAGACAGG + Intergenic
1097440702 12:59604656-59604678 GTTATCCTCATTTTACAGATGGG + Intronic
1097686386 12:62694909-62694931 GTTATCCCCATTTTGCAGAAAGG - Intronic
1097986757 12:65791149-65791171 TCTAGCTCCATTTTCCAGAAAGG + Intergenic
1098044129 12:66382460-66382482 GTTATCCCCATTTTACACTGAGG - Intronic
1098048611 12:66428687-66428709 TCTATCTCCATTTTACAAAGAGG - Intronic
1098164214 12:67677044-67677066 GTTATCCCCATTTTACAGATGGG + Intergenic
1098623412 12:72634140-72634162 ATTATCCCCATTTTCCAGAAGGG + Intronic
1100452709 12:94722735-94722757 GCTTTCCTCAGTTTCCAGGGGGG + Intergenic
1101098919 12:101372166-101372188 GGTATCCCCATTTTACCGCGAGG + Intronic
1101282373 12:103271537-103271559 ACTGTCCCCATTTTACAGAGGGG - Intronic
1101324585 12:103703901-103703923 ACTATCCCCATTTTACAGATGGG + Intronic
1101330449 12:103753603-103753625 ACTATTCCCATTTTACAGATAGG + Intronic
1101513710 12:105415367-105415389 AGTAGCCCCATTTTACAGAGAGG - Intergenic
1101517305 12:105448733-105448755 GTTATTACCATTTTCCAGATGGG + Intergenic
1101556881 12:105818514-105818536 ATTATCCCTATTTTCCAGATAGG + Intergenic
1101594301 12:106150359-106150381 ATTATCCCCATTTTCTAGATGGG - Intergenic
1101813532 12:108128751-108128773 ACTGTCCCCATTTTACAGATGGG + Intergenic
1101841578 12:108331248-108331270 GCCATCCCCATTTCACAGATGGG + Intronic
1101987675 12:109460547-109460569 ACTGCCCCCATTTTGCAGAGAGG + Intronic
1102176607 12:110880300-110880322 ATTATCCCCATTTTACAGACTGG + Intronic
1102216040 12:111162077-111162099 GTTATGCCCATTTTACAGAGGGG + Intronic
1102217903 12:111174605-111174627 GTTGTGCCCATTTTGCAGAGGGG + Intronic
1102464151 12:113118757-113118779 GCTATCCGCATTTTACAGATGGG - Intronic
1102543776 12:113640199-113640221 GTTATCCTCATTTTTCAGATGGG + Intergenic
1102622556 12:114207992-114208014 GCTATCCCCAGTTGCAAGGGAGG - Intergenic
1102636137 12:114326040-114326062 CTTATCCCCATTTTACAGATGGG + Intergenic
1102701103 12:114840152-114840174 GCTTTCATCTTTTTCCAGAGTGG + Intergenic
1102723841 12:115041082-115041104 GCTACCCCCAATTCACAGAGGGG + Intergenic
1102928850 12:116847405-116847427 TCTATCCCCATTTTACAGATGGG + Intronic
1102957817 12:117070705-117070727 ACTCTCCCCATTTTACAGATGGG - Intronic
1103041593 12:117700230-117700252 GTTATCCTCATTTTACAGAGGGG + Intronic
1103061043 12:117858802-117858824 GTTATCCCCCTTGTACAGAGTGG - Intronic
1103167249 12:118780639-118780661 ATTGTCCCCATTTTCCAGATGGG - Intergenic
1103197569 12:119058421-119058443 GTTGTCCCCATTTTACAGAAAGG + Intronic
1103220396 12:119239490-119239512 GAAATCCCCATTTGCTAGAGAGG - Intergenic
1103483857 12:121269361-121269383 GGTATGCCCATTTTACAGATAGG - Intronic
1103835176 12:123813365-123813387 GCTTTGTCCAATTTCCAGAGAGG - Exonic
1104370031 12:128216256-128216278 ACTATGCCCATTTCACAGAGGGG - Intergenic
1104653372 12:130554707-130554729 ATTATCCCCATTTTAGAGAGAGG + Intronic
1105562909 13:21512042-21512064 ACAATCACTATTTTCCAGAGTGG + Intronic
1105816535 13:24041182-24041204 GCTTCTCCCATTTTCCAGTGTGG - Intronic
1106240348 13:27907056-27907078 TTTATCCCCACTTTACAGAGGGG + Intergenic
1106419410 13:29573009-29573031 GCTATCTGCATTTTCAAGAAAGG - Intronic
1106536226 13:30645805-30645827 CTTATCCCCATTTTACAGATGGG - Intronic
1106708074 13:32302623-32302645 ACTATCCCCATTTTACAGATAGG + Intergenic
1107199696 13:37699132-37699154 ACTATCCCCATTTTACAAATTGG - Intronic
1107398778 13:40048146-40048168 GCCATCCCCATTCTCAAGGGAGG - Intergenic
1107572299 13:41675774-41675796 GTTATCCCCATTTTACAGTGGGG - Intronic
1107726594 13:43305726-43305748 ACCATCCCCATTTTCCTCAGAGG + Intronic
1108544435 13:51478147-51478169 GTTATACCCATTTTACAGATAGG - Intergenic
1112797338 13:103070748-103070770 GCTATAATCATTTTCCAAAGTGG - Intergenic
1113054511 13:106253647-106253669 ACTATTCTCATTTTACAGAGGGG - Intergenic
1113582116 13:111437288-111437310 GTTATCCCCATTTCACAGATGGG + Intergenic
1115343533 14:32318112-32318134 ATTATCCCCATTTCCCAGAGGGG + Intergenic
1115763685 14:36600980-36601002 GCTCTCTCCATTTTACTGAGAGG - Intergenic
1117627705 14:57656646-57656668 GTTATCCCCACTTTACAGAGGGG - Intronic
1117781004 14:59232025-59232047 TTTATCCCCACTTTACAGAGAGG + Intronic
1118430906 14:65717652-65717674 GCGCTCCCCATTTCCCAGACGGG + Intronic
1118770318 14:68938465-68938487 GTTATCCCCATTTTACAGATAGG - Intronic
1118899330 14:69973354-69973376 GTTATCCCCATTTTATAGATGGG + Intronic
1119159789 14:72443254-72443276 GCTGGCCCCATTTTGCAGATGGG + Intronic
1119182986 14:72616904-72616926 GCTATCCCCGCTTTCCAGATGGG + Intergenic
1119487636 14:75002107-75002129 CTTATCCCCATTTTACAGATTGG - Intergenic
1119641101 14:76315522-76315544 GTTATCCCCATTTTGCAGATGGG - Intronic
1119902115 14:78270052-78270074 ACTGTCCCCATTTTACAGATGGG + Intronic
1120727881 14:87966129-87966151 ATTATCCTCATTTTACAGAGAGG - Intronic
1120885013 14:89445244-89445266 ACCATCCCCATTTTACAGATGGG - Intronic
1121176782 14:91896568-91896590 ACAATCCCCATTTTACAGATGGG + Intronic
1121279130 14:92687179-92687201 GCTATCCCCACTTTACAGCCGGG + Intronic
1121282925 14:92712437-92712459 TTTATCCCCATTTTACAGATGGG + Intronic
1121495633 14:94389899-94389921 ACCATCCCCATTTTACAGATAGG - Intronic
1121572743 14:94959772-94959794 GATATTCCCATTTTGCAGAGGGG + Intergenic
1121644910 14:95511173-95511195 GTTATTTCCATTTTCCAGTGGGG - Intergenic
1121718347 14:96091857-96091879 GTTATCCAGATTTTTCAGAGAGG - Exonic
1121737559 14:96228955-96228977 GCTATTCCCATGTTCCAGATGGG - Intronic
1122116457 14:99529959-99529981 AGTGTCCCCATTTTGCAGAGGGG + Intronic
1122140822 14:99661981-99662003 TCTGTACCCATTTTCCAGATGGG - Intronic
1122412207 14:101531437-101531459 GCTGTCCCCATTTTACAGCTGGG + Intergenic
1123928585 15:25144314-25144336 TCTTTCCCCATTTTGCAGAAAGG - Intergenic
1124134173 15:27019496-27019518 CCTGTTCCCATTTTACAGAGAGG - Intronic
1124335137 15:28850099-28850121 GCGCTCCTCATTTTCCAGACTGG + Intergenic
1124614419 15:31231253-31231275 GTTATCCCCATTTTCTTGATAGG + Intergenic
1124797814 15:32799662-32799684 AGAATCCCAATTTTCCAGAGTGG + Intronic
1124846330 15:33294741-33294763 GTTATTCCCATTTTACAGATAGG + Intergenic
1125265138 15:37870313-37870335 ATTATTCCCATTTTACAGAGTGG - Intergenic
1125343665 15:38698120-38698142 GTTATCCCCATTTTACAGGGAGG + Exonic
1125357263 15:38829447-38829469 ATTATCCCCATTTTACAGAAGGG - Intergenic
1126136497 15:45397366-45397388 CCTACCTCCATTCTCCAGAGAGG + Intronic
1126667930 15:51091999-51092021 GTTATCCTCATTTTACAGAGTGG + Intronic
1126783001 15:52154453-52154475 GCTATGCCCATTTAGCAGATGGG + Intronic
1127255549 15:57289715-57289737 GTTATCTCCATTTTTCAGATAGG - Intronic
1127831746 15:62757124-62757146 CTTATCCCCATTTTACAGATGGG + Intronic
1127871754 15:63079860-63079882 ATTATCCCCATTTTGCAGATGGG - Intergenic
1127873602 15:63093444-63093466 ATTATCCCCATTTTACAGAAAGG + Intergenic
1127950724 15:63803245-63803267 ATTATCCCCATTTTCCAGGAAGG + Intronic
1128549718 15:68590413-68590435 GTTACCCCCACTTTTCAGAGGGG + Intronic
1128564853 15:68694362-68694384 GCTATTCTCATTTTAGAGAGGGG + Intronic
1128699977 15:69796958-69796980 ATTGTCCCCATTTTACAGAGAGG - Intergenic
1128806641 15:70536082-70536104 TCTTTCCCCCTTTTCCAGATGGG + Intergenic
1128933630 15:71727179-71727201 ATAATCCCCATTTTTCAGAGTGG - Intronic
1129049658 15:72769853-72769875 ATTATCCCCATTTTGCAGATAGG - Intronic
1129307800 15:74680467-74680489 TCTATTCCCATTTTTCTGAGAGG - Intronic
1129447993 15:75632143-75632165 GTTAACCACATTTTACAGAGAGG - Intergenic
1129599961 15:76993118-76993140 ATTATCCCCACTTTACAGAGGGG - Intergenic
1129793633 15:78359838-78359860 ACTGTCCCCATTTTACAGACGGG + Intergenic
1130127217 15:81104029-81104051 ACTATCCCCATTTTCCAGATGGG + Intronic
1130169432 15:81496603-81496625 ACTATCCCCATTTCACAGATTGG + Intergenic
1130652059 15:85767800-85767822 ACTGTCCCCATTTTGCAGACTGG + Intronic
1130896455 15:88173916-88173938 GTTGTCCCCATTTTACAGATGGG - Intronic
1131022373 15:89109583-89109605 GCCCTCCCCACTTTCCAGACAGG - Intronic
1131098516 15:89670810-89670832 GTTATCTCCATTTTACAGAGAGG - Intronic
1131195984 15:90355333-90355355 ACTATCCCCCTTTTCCAGCCTGG + Intronic
1132047246 15:98574745-98574767 GCTCTCCCCATTTTAGTGAGTGG - Intergenic
1132889893 16:2198389-2198411 CATATCCTCATTTTACAGAGGGG - Intergenic
1133320422 16:4910154-4910176 GTTATCCCCATGTTACAGAAAGG + Intronic
1133474786 16:6110314-6110336 GCAATCATCAATTTCCAGAGAGG - Intronic
1133754251 16:8750771-8750793 AATATCCCCATTTTGCAGATAGG + Intronic
1134069628 16:11252888-11252910 GCTGGCCCCATTTTACAGATGGG - Intronic
1134226030 16:12390766-12390788 GTTGTCCCCATTTTCCAGGAGGG + Intronic
1134428409 16:14176700-14176722 ACTATCTCCATTTTACAGTGAGG - Intronic
1134500917 16:14768582-14768604 GTTATGCCCATTTTACAGATGGG - Intronic
1134569194 16:15277105-15277127 GCTATCCCCATTGTCACAAGGGG + Intergenic
1134579665 16:15360467-15360489 GTTATGCCCATTTTACAGATGGG + Intergenic
1134715039 16:16353731-16353753 GTTATGCCCATTTTACAGATGGG - Intergenic
1134722917 16:16397092-16397114 GTTATGCCCATTTTACAGATGGG - Intergenic
1134733183 16:16478940-16478962 GCTATCCCCATTGTCACAAGGGG - Intergenic
1134934255 16:18233033-18233055 GCTATCCCCATTGTCACAAGGGG + Intergenic
1134944511 16:18314779-18314801 GTTATGCCCATTTTACAGATGGG + Intergenic
1134951776 16:18354928-18354950 GTTATGCCCATTTTACAGATGGG + Intergenic
1135038819 16:19101792-19101814 TTTATCCCCATTTTGCAGACAGG - Intergenic
1135213144 16:20541124-20541146 TTTATCCCCATTTTGCAGACGGG - Intronic
1135341049 16:21648317-21648339 ACTATCCCCATTTTCTAATGAGG - Intronic
1135614869 16:23902540-23902562 GCAGTCCCCATTTTACAGACGGG + Intronic
1135738298 16:24951312-24951334 GTGATCCACATTTTACAGAGAGG - Intronic
1135918023 16:26623631-26623653 GTTATCCCCATTCTCCAGATGGG + Intergenic
1135936416 16:26784363-26784385 GTTATCCCCATTGTCCAGATGGG + Intergenic
1135958088 16:26973062-26973084 GTCATCCCCATTTTACAGATGGG - Intergenic
1136003098 16:27311227-27311249 ATTATCCCCATTTTACAGATGGG + Intergenic
1136149701 16:28339326-28339348 GTTATGCCCATTTTACAGATGGG + Intergenic
1136165937 16:28453137-28453159 GTTATGCCCATTTTACAGATGGG + Intergenic
1136183489 16:28571125-28571147 GCTAACCCCATTCTTGAGAGTGG - Intronic
1136197035 16:28661883-28661905 GTTATGCCCATTTTACAGATGGG - Intergenic
1136213374 16:28776006-28776028 GTTATGCCCATTTTACAGATGGG - Intergenic
1136258107 16:29055923-29055945 GTTATGCCCATTTTACAGATGGG - Intergenic
1136320388 16:29480386-29480408 GTTATGCCCATTTTACAGATGGG + Intergenic
1136434961 16:30219726-30219748 GTTATGCCCATTTTACAGATGGG + Intergenic
1136534144 16:30889273-30889295 ATTATCCCCATTTTACAGATGGG - Intronic
1136688160 16:32008288-32008310 ACCATCCCCATTTTACAGATGGG + Intergenic
1136788764 16:32951843-32951865 ACCATCCCCATTTTACAGATGGG + Intergenic
1136881049 16:33902091-33902113 ACCATCCCCATTTTACAGATGGG - Intergenic
1138517086 16:57542096-57542118 ATTATCTCCATTTTACAGAGGGG + Intergenic
1138529236 16:57626041-57626063 TCTATCCCCACTTTACAGAAGGG - Intronic
1138816263 16:60206345-60206367 ACTATTCTCATTTTACAGAGGGG + Intergenic
1139339956 16:66262059-66262081 GTTATTTCCATTTTGCAGAGGGG - Intergenic
1139884712 16:70200243-70200265 GTTATGCCCATTTTACAGATGGG + Intergenic
1139925605 16:70484138-70484160 GGTACCCCCATATTACAGAGGGG - Intronic
1140122713 16:72097510-72097532 CCTATCCCCATTCTCCCAAGGGG - Intronic
1141610753 16:85179910-85179932 TCTGCCCCCATTTTCCAGAGGGG - Intronic
1141631612 16:85291122-85291144 ATTATCCCCATTTTACAGAAGGG + Intergenic
1141632845 16:85298053-85298075 GTAATCTCCATTCTCCAGAGAGG + Intergenic
1141672169 16:85497890-85497912 GTTATCCCCTTTTTACAGATGGG + Intergenic
1141676180 16:85518599-85518621 GCTGTCCCCATTTTACAGCTGGG - Intergenic
1141969631 16:87472270-87472292 GCTGTCCCCACTTTACAGATGGG - Intronic
1142339665 16:89513118-89513140 CATCTCCCCATTTTCCAGACTGG - Intronic
1142420657 16:89967476-89967498 CCTGCCCCCATTTTCCAGATGGG - Exonic
1203090961 16_KI270728v1_random:1213332-1213354 ACCATCCCCATTTTACAGATGGG + Intergenic
1142640534 17:1283209-1283231 GTTATACCCATTTTGCAGATGGG - Intronic
1143272615 17:5687001-5687023 GTTATCCCCATTTTACAGCTGGG + Intergenic
1143322980 17:6080137-6080159 GTTGTCCCCATTTTACAGATGGG + Intronic
1143375003 17:6462112-6462134 ATTATGCCCATTTTACAGAGGGG - Intronic
1143382456 17:6504812-6504834 ACTATCCCCATTTTATAGATTGG - Intronic
1144116469 17:12097695-12097717 TCTATCCCCTTTTTCCAGATAGG + Intronic
1144258610 17:13495633-13495655 ATTATCCCCATTTTACAGAAAGG - Intergenic
1144951466 17:18996698-18996720 GCCACTCCCATTTTCCAGAGGGG + Intronic
1145166345 17:20615525-20615547 CCTGCCCCCATTTTCCAGATGGG - Intergenic
1146269893 17:31477867-31477889 ATTATCCCCATTTTACAGATGGG - Intronic
1146277637 17:31525300-31525322 GCTATCCCCATTTTATAGATGGG + Intronic
1146558134 17:33844894-33844916 AGTATCCCCATTTTACAGATGGG + Intronic
1146637462 17:34517084-34517106 GCTGTCCCCATTTTACAGATGGG - Intergenic
1146723790 17:35141680-35141702 AATATCCCCATTTTACAGCGTGG - Intronic
1146910703 17:36646716-36646738 GTTCTCCCCATTTTACAGATGGG + Intergenic
1147796097 17:43044202-43044224 ATTACCCCCATTTTACAGAGTGG + Intergenic
1147816153 17:43212187-43212209 ACTATCCCCACTCTCCAGTGCGG + Intronic
1147899618 17:43775410-43775432 GTTATCCCCATTTTACAGAGAGG - Intronic
1148160264 17:45445760-45445782 GCTATCTTCATTTTACAGATGGG + Intronic
1148491133 17:48024524-48024546 GCTCTCCCCATTTTACGGAAGGG - Intergenic
1148770226 17:50062239-50062261 GCTGCCCCCATTTTACAGATGGG + Intronic
1148859657 17:50597363-50597385 ATGATCCCCATTTTACAGAGGGG + Intronic
1148988611 17:51646218-51646240 GCCATCCCCAGTTTACAGATGGG - Intronic
1148991483 17:51670325-51670347 ACTGTCCCCATTTACCAGATGGG + Intronic
1149450970 17:56749785-56749807 GTTACCCCCATTTTACAGATAGG - Intergenic
1149975740 17:61264066-61264088 GTTAACCCCATTTTACAGACAGG - Intronic
1150391555 17:64792639-64792661 GCTATCTTCATTTTACAGATGGG + Intergenic
1150410369 17:64936776-64936798 GCTATCTTCATTTTACAGATGGG + Intergenic
1150475604 17:65472225-65472247 CCTATCCCCATTTTACAGATGGG - Intergenic
1150478800 17:65493713-65493735 GCCATACCTATTTTTCAGAGCGG - Intergenic
1150570925 17:66386490-66386512 AATATTCCCATTTTACAGAGGGG - Intronic
1150579456 17:66458943-66458965 GTTATCCCCATTTTACAGATGGG + Intronic
1151085419 17:71374758-71374780 TCTATACCCATTTTACAGATTGG - Intergenic
1151328849 17:73394937-73394959 GCTATTCCCATATTCCCAAGGGG - Intronic
1151870438 17:76833128-76833150 ATTATCCCCATTTTACAGAGGGG - Intergenic
1152108420 17:78343641-78343663 GTTATCCCCATTGTACAGATGGG + Intergenic
1152389278 17:79993102-79993124 GCCAGCCCCATTGTGCAGAGGGG + Intronic
1153344676 18:4012524-4012546 GCTATCCCCAAGCTACAGAGGGG + Intronic
1154116420 18:11616097-11616119 GTTATGCCCATTTTACAGATGGG + Intergenic
1155040748 18:22063859-22063881 GCAATCCCCATTTTACAGATGGG + Intergenic
1155300832 18:24427142-24427164 GCTATTGCCATTTTGCAAAGGGG - Intronic
1155727928 18:29112809-29112831 ATTATCCCTATTTTCCAGATGGG - Intergenic
1157577166 18:48751020-48751042 GTTCACTCCATTTTCCAGAGAGG - Intronic
1157674670 18:49560478-49560500 GTTATCTCCATTTTACAGATGGG - Intergenic
1157842822 18:50975210-50975232 TTTATCCCCATTTTCAAGATCGG - Intronic
1157891508 18:51422537-51422559 GTGATCCCCATTTTACAGATGGG + Intergenic
1157918581 18:51693586-51693608 GTTATCCATATTTTTCAGAGGGG - Intergenic
1158136953 18:54218619-54218641 GTTATCTCCATTTTACAGATTGG - Intronic
1158432772 18:57404817-57404839 ACTATCCTCATTTTACAGAAAGG - Intergenic
1158539823 18:58343029-58343051 GCTATCCTCATTTCCCAGCCGGG - Exonic
1158585690 18:58731913-58731935 GATATACCCATTTTCAAGTGTGG - Intronic
1160681296 19:412763-412785 ACCATCGCCAGTTTCCAGAGAGG + Intergenic
1161240148 19:3218467-3218489 GTCATCCCCATTTCTCAGAGGGG - Intergenic
1161290262 19:3490389-3490411 GCTATGCCTATTTTACAGAGAGG + Intergenic
1161303159 19:3552850-3552872 ATTATCCTCATTTTCCAGATGGG + Intronic
1162084764 19:8241845-8241867 GCTGTACCCATTTTTCAGATGGG + Intronic
1162417815 19:10548691-10548713 GACATCCCCATTTTACAGAGTGG - Intronic
1162531943 19:11241295-11241317 TTTATCCCCATTTTACAGATGGG + Intronic
1162866305 19:13550050-13550072 GTTATCCCCATTTCCCTGATTGG - Intronic
1162871307 19:13588973-13588995 GTTTTCCCCATTTGACAGAGAGG + Intronic
1163221784 19:15927067-15927089 GTTATTCCCATTTTACAGATAGG + Intronic
1163362563 19:16856365-16856387 ACTATCCCCATTTTACAGCAAGG - Intronic
1163528912 19:17838139-17838161 GCTGGCCCCATTTTACAGATGGG + Intronic
1163577543 19:18119502-18119524 GCTGAGCCCATTTTCCAGACTGG - Intronic
1163829993 19:19543050-19543072 GCTTTCCCCACTCTCCAGATGGG - Intronic
1164648308 19:29874464-29874486 GGCATCCCCAGTTTACAGAGGGG - Intergenic
1164744955 19:30605058-30605080 ATTATCCCCATTTTACAGATGGG + Intronic
1164796008 19:31030830-31030852 AATATCCCCATTTTACAGATTGG - Intergenic
1165064778 19:33222589-33222611 TTTATACCCATTTTACAGAGTGG - Intronic
1165341005 19:35212210-35212232 GCTAACCCCATTTTACATAGGGG + Intergenic
1165802883 19:38563661-38563683 ATTATGCCCATTTTACAGAGGGG + Intronic
1165951491 19:39476063-39476085 GCTGTCCCCATCCTCCAGGGGGG + Exonic
1166130595 19:40743594-40743616 GTTACCCCCAATTTCCAGATGGG + Intronic
1166786107 19:45368282-45368304 ATTATCCCCATTTTACAGAAAGG + Intronic
1166798539 19:45442550-45442572 GCTATGCCCATTTTAGAGATGGG + Intronic
1167148666 19:47696671-47696693 GGTCACCCCATTTTCCAGAGGGG - Intronic
1167148998 19:47698407-47698429 GCTATCCCCATTTTACAGAAAGG - Intronic
1167457608 19:49605672-49605694 ACCATCCCCATTTTACAGATGGG + Intronic
1167649312 19:50720726-50720748 GCCATCCCCATTTTCCAGAGGGG + Intergenic
1168085475 19:54042553-54042575 GCTATCCTCACTTTACAGATGGG - Intronic
1168307655 19:55444053-55444075 CTTATCCCCATTTTACAGATGGG - Intergenic
1168321936 19:55516000-55516022 TTTATCCCCATTTTACAGAAGGG - Intronic
925359830 2:3270064-3270086 GCTGTCCACATTGTCCAGATGGG + Intronic
926208645 2:10852207-10852229 TCAATCCCCAATCTCCAGAGAGG + Intronic
926336029 2:11863623-11863645 GCTATGCCCATCTTACAGATGGG - Intergenic
926729341 2:16024177-16024199 ACTACCCTCATTTTCCAGACAGG - Intergenic
926939671 2:18121659-18121681 TCCATACCCATTTTCCATAGTGG - Intronic
927651786 2:24917880-24917902 GTTATCCCCATTTGACAAAGGGG + Intronic
928292926 2:30055742-30055764 TATATCCCCATTTTACAGACGGG - Intergenic
928742157 2:34368161-34368183 GCTCTTCCCATTTTATAGAGAGG + Intergenic
929419100 2:41772884-41772906 GTTATACCCATTTTACAGATGGG - Intergenic
929468162 2:42164648-42164670 ATTATCCCCATTTTTCAGACAGG - Intergenic
930304026 2:49655083-49655105 GCTATTCCCATTTACAAAAGAGG - Intergenic
931068134 2:58611192-58611214 ATTATCCCCATTTTTCAGATGGG + Intergenic
931250761 2:60528915-60528937 GTTATCTCCATTTCACAGAGAGG + Intronic
931358815 2:61560218-61560240 GTTATCCTCATTTTACAGATGGG - Intergenic
931462176 2:62458529-62458551 GCTCTGCCCATTTTGCAGATGGG - Intergenic
932694679 2:73945503-73945525 GTAATGCCCATTTTCCAGAGGGG - Intronic
933245864 2:79974206-79974228 ATTATCCCCATTTTACAGATTGG - Intronic
934885022 2:98016763-98016785 ACTATCCTCATCTTCCAGATGGG + Intergenic
935198454 2:100835169-100835191 GCTCTTCCCATTTTCCATACAGG + Intronic
935222554 2:101027819-101027841 GTTATCCCCATTTTACACGGGGG + Intronic
936054794 2:109254375-109254397 GCTGCCCCCATTTTACAGATGGG - Intronic
936087664 2:109480327-109480349 GCTATCCCCAGTTTACAGATGGG + Intronic
937017077 2:118616203-118616225 GTTATCCCCAATTTACAGAAGGG - Intergenic
937223240 2:120353838-120353860 GCTCCCCCCATTTCCCAGACAGG + Intergenic
939952997 2:148497953-148497975 ATTATCCCCATTTTACAGATGGG + Intronic
940050805 2:149461865-149461887 GCTATTCCTATTTTTCTGAGAGG - Intronic
940975862 2:159943610-159943632 AATATCCCCATTTTACAGACGGG - Intronic
941695239 2:168544368-168544390 ATTATCCCCACTTTGCAGAGAGG - Intronic
942445128 2:176072465-176072487 ATTATCCCCATTTTACAGAGGGG - Intergenic
944129966 2:196337146-196337168 GCTCTCCCCCTTTGTCAGAGGGG - Intronic
944683408 2:202097164-202097186 TGTATCCCCATTTTACAGATTGG + Intronic
945194610 2:207226690-207226712 GCTATCCCCATTTCACAAAGAGG + Intergenic
945740706 2:213657316-213657338 TATATCCCCATTTTACAGAAGGG - Intronic
946484239 2:220085656-220085678 TTTATCCCCATTTTACAGAAGGG + Intergenic
947783782 2:232795876-232795898 ACTATCCCCATTTTACAGAGGGG - Intronic
947857525 2:233334128-233334150 AAGATCCCCATTTTCCAGACGGG - Intronic
948330044 2:237157360-237157382 GCTATCCCCACTTACAAGTGAGG + Intergenic
948362310 2:237431435-237431457 GCTTTGCCCATTTTACAGATTGG - Intergenic
1168765042 20:376312-376334 GTTATCCCCATTTTACAGATGGG + Intronic
1168970200 20:1925696-1925718 GCTAAACCCATTTTACAGATGGG - Intronic
1168984773 20:2038726-2038748 AATATCCCCATTTTCCAGATGGG - Intergenic
1169195144 20:3678796-3678818 GATATGCTCATTTTACAGAGGGG - Intronic
1169265934 20:4167459-4167481 CCTATCCCCATTTTACGGATGGG + Intronic
1169318425 20:4611706-4611728 GTTATCCCCATTTTGCAGGTGGG - Intergenic
1169614117 20:7419593-7419615 GCTCCTCCCAGTTTCCAGAGTGG - Intergenic
1170467205 20:16632942-16632964 GCTATCTCCATTTTGCAGATGGG + Intergenic
1171058735 20:21934549-21934571 GCTATCCCCATAGGCAAGAGAGG + Intergenic
1171992208 20:31705367-31705389 ATTATCCCCATTTTTCAGATAGG + Intronic
1172011520 20:31848658-31848680 CCTACCCCCATTTTCCAGGTAGG + Intronic
1172126174 20:32626633-32626655 GTTAGCTCCATTTTCCAGATGGG - Intergenic
1172474734 20:35227800-35227822 ATTATCCCCATTTTACAGATGGG + Intronic
1172478437 20:35256220-35256242 GCTATCTTCATTTTACAGATAGG + Intronic
1172549893 20:35790559-35790581 GATATCCTCATTTTACAGATGGG + Intronic
1172555742 20:35839531-35839553 CTTCTCCCCATTTTACAGAGAGG + Intronic
1172611825 20:36258272-36258294 ACTATCCCCATTTTGCTGATGGG + Intronic
1172838900 20:37890294-37890316 ACTATCCCCATTTTACTGATGGG - Intergenic
1173360096 20:42335989-42336011 GTTATCCCTATTTTACAGATGGG - Intronic
1173681912 20:44888394-44888416 GTTAGCCCCATTTTACAGATGGG + Intronic
1173723933 20:45283749-45283771 GCTACTCCCATTTTGCAGAAGGG - Intergenic
1173853267 20:46232384-46232406 GTTATCTCCATTTTACAGAAGGG - Intronic
1173912405 20:46680023-46680045 GCCATACCCATTTTACAGATGGG - Intronic
1174196494 20:48776162-48776184 TGTGTCCCCATTTTACAGAGGGG - Intronic
1174203033 20:48820328-48820350 GTCATCCCCATTTTGCAGATGGG + Intronic
1174398936 20:50265387-50265409 GCTATCCCCATTTCATAGATGGG + Intergenic
1174545865 20:51324617-51324639 AATATCCCCAATTTCCAGATGGG - Intergenic
1174559010 20:51416743-51416765 AATATCCCCATTTTGCAGATGGG + Intronic
1174580086 20:51565172-51565194 AGTGTCCCCATTTTACAGAGTGG - Intergenic
1174637984 20:52018289-52018311 ACTTTCCCCATTTTACAGACGGG - Intergenic
1174762186 20:53216962-53216984 CCCATCCCCAGTTTCCAAAGAGG + Intronic
1174766676 20:53260988-53261010 ATTATCCTCATTTTGCAGAGAGG + Intronic
1174777678 20:53360702-53360724 ATTATCCCCATTTTTCAGATGGG + Intronic
1175267449 20:57711018-57711040 ACTCTCCCCATTTTACAGAGCGG + Intronic
1175398226 20:58682525-58682547 AACATCCCCCTTTTCCAGAGGGG + Intronic
1176281925 20:64318182-64318204 ACTTGCCCCATTTTACAGAGGGG + Intergenic
1176958037 21:15128795-15128817 CATATCCCCATTTTACAAAGAGG - Intergenic
1177523103 21:22255970-22255992 ACTATCTCAATTTTCCAGATAGG - Intergenic
1178877431 21:36423562-36423584 TGCATCCCCATTTTACAGAGAGG - Intergenic
1179024159 21:37666475-37666497 TGTATCCCCATTTTACAGATTGG - Intronic
1179573458 21:42291946-42291968 GCTGGCCCCATTTTACATAGGGG + Intronic
1179730885 21:43366835-43366857 GCTGTGCCCATTTCCCAGCGAGG - Intergenic
1181006790 22:20017296-20017318 GCTATCCCCATTTTACAGTTGGG + Intronic
1181540339 22:23569597-23569619 ACTATGCCCATTTTACAGATGGG - Intergenic
1181732089 22:24854859-24854881 ATTATCCCCATTTTACAGATGGG + Intronic
1181762826 22:25069640-25069662 GCCATCCCCATTTTACAGAGAGG - Intronic
1182062765 22:27409703-27409725 ACTATTCCCATTTTGCAGAAGGG - Intergenic
1182092766 22:27607121-27607143 GGTACCCCCATTTTCCTGGGGGG + Intergenic
1182453238 22:30433428-30433450 ACTATCCCCATTTCACAGAAGGG - Intergenic
1182475203 22:30573396-30573418 CCTATCCCCATTATCCAGAGGGG - Intronic
1182786747 22:32914395-32914417 ACTATCCCCATATTACAGATGGG - Intronic
1182825846 22:33263972-33263994 ACTAGACCCATTTTACAGAGGGG - Intronic
1183218291 22:36495509-36495531 GTAATCCCCATTTTACAGAGGGG + Intronic
1183236621 22:36623499-36623521 TGTTACCCCATTTTCCAGAGAGG - Intronic
1183248517 22:36711766-36711788 GCTGCCCCCATTTTCCAGACAGG - Intergenic
1183317941 22:37147230-37147252 ATTATCCCCATTTTCCAATGAGG + Intronic
1183424663 22:37733114-37733136 ACCATCCCCATTTTTCAGAAGGG + Intronic
1183450731 22:37893501-37893523 GCTAACCCCATTTTAGAGAAAGG - Intergenic
1183464190 22:37971294-37971316 GTTATCTCAATTTTCCAGATGGG - Intronic
1183475693 22:38034637-38034659 ATTATCCCCATTTTACAGAGGGG - Intronic
1183581814 22:38730836-38730858 CCCACCCCCATTTTCCAGGGGGG + Exonic
1183696615 22:39427297-39427319 GGTACCCCTGTTTTCCAGAGAGG + Intronic
1183787720 22:40040338-40040360 GTTATCCACATTTTCTAGATAGG - Exonic
1183952185 22:41358118-41358140 CCAAACCCCATTTTGCAGAGAGG + Exonic
1184019736 22:41813017-41813039 GCTGTTCCCATTTTACAGATGGG - Intronic
1184031518 22:41897706-41897728 GGTACCCCCATCTTCCAGGGTGG - Intronic
1184363974 22:44037581-44037603 GTTATTCCCATTTTGCAGATGGG + Intronic
1185109171 22:48891375-48891397 ACCATCCCCAGTTTCCAGGGAGG + Intergenic
949488752 3:4567062-4567084 ATTATCCCCATTTTACAGATGGG - Intronic
949649552 3:6140439-6140461 GTTATCCACATTTTACAGTGGGG + Intergenic
950076392 3:10190184-10190206 TCTTTACCCATTTTCCAGATGGG - Intronic
950149191 3:10673054-10673076 ACTACCCCCATTTTCCAGAGGGG - Intronic
950181974 3:10919813-10919835 GCTACCCCCATTTTACAGATGGG + Intronic
950219758 3:11185674-11185696 ATTATCCCCATTTTCCAGATAGG - Intronic
950437907 3:12991806-12991828 CCTTCCCCCATTGTCCAGAGGGG - Intronic
950668537 3:14511655-14511677 GCCACCCCCATTTTACAGGGGGG - Intronic
950672239 3:14534254-14534276 GACACCCCCATTTTACAGAGGGG - Intronic
950692325 3:14669709-14669731 ATTATCCCCATTTTATAGAGGGG - Intronic
950711033 3:14812967-14812989 GCCATCCCCATTTTATAGATGGG + Intergenic
950914969 3:16635505-16635527 ATTATCCCTATTTTTCAGAGAGG - Intronic
951531299 3:23700958-23700980 ATTATTCCCATTTTACAGAGGGG + Intergenic
951600802 3:24372700-24372722 ACCATCCCCATTTTACAGACAGG + Intronic
951987881 3:28641136-28641158 ACCATCCCCATTTTCCAGAATGG + Intergenic
952157357 3:30657524-30657546 TCTACTCCCATTTTTCAGAGAGG - Intronic
952818501 3:37466019-37466041 ATTATCCCCATTTTACAGATAGG - Intronic
952961348 3:38591768-38591790 ATTATCCCCATTTTACAGATAGG + Intronic
953012249 3:39038338-39038360 ACTATCCTCATTTTCTATAGTGG + Intergenic
953140883 3:40228186-40228208 GCTGTCCCCTTTTCACAGAGGGG + Intronic
953162183 3:40431497-40431519 AATACCTCCATTTTCCAGAGTGG - Intergenic
953911868 3:46897283-46897305 ACTGGCCCCATTTTCCAGATGGG - Intronic
954004985 3:47583559-47583581 GGCATGGCCATTTTCCAGAGGGG + Intergenic
954461500 3:50629529-50629551 ACTATCCCCACTTTCCAGATTGG + Intronic
954694311 3:52412613-52412635 ATTATCCCCATTTTCAAGATGGG - Intronic
955193552 3:56784354-56784376 TCCAGCCCCATTTTCCAGACCGG - Intronic
955507522 3:59647129-59647151 ATTATCCCCATTTTACAGATGGG + Intergenic
955721939 3:61892107-61892129 GTTATCTCCATTTTACAGATGGG + Intronic
956040901 3:65143886-65143908 GTTATCCCCATTTCACAGATGGG + Intergenic
956114930 3:65908742-65908764 CTGATCCACATTTTCCAGAGGGG - Intronic
956186548 3:66568050-66568072 ATTATCCCCAATTTACAGAGTGG + Intergenic
956361309 3:68450934-68450956 GTTATCCCCATTTTACAATGAGG + Intronic
956591178 3:70916539-70916561 GTTATCTCCATTTTACAGAAGGG + Intergenic
956750658 3:72341574-72341596 ACTATTCCCATTTTACAGATAGG - Intergenic
957220652 3:77378344-77378366 GTTATCCCCATTTTATAGAATGG + Intronic
961318364 3:126055973-126055995 ATTATCCCCATTTTACAGATGGG + Intronic
961481232 3:127182602-127182624 CCTGTCCCCACTTTCGAGAGGGG - Intergenic
961818227 3:129562048-129562070 GCCCTCCCCATTTTACAGATGGG - Intronic
962054141 3:131850796-131850818 TTTATCCCCATTTTGTAGAGTGG + Intronic
962101273 3:132345185-132345207 AATATCCCCATTTTGCAGAATGG - Intronic
964071377 3:152637774-152637796 TCTGTCCCCATTTTGCGGAGGGG + Intergenic
964677250 3:159297448-159297470 GCTATTCTCATTTTTCAGGGAGG + Intronic
964821471 3:160775128-160775150 GTTATCCCCATTTTACAGTTGGG + Intronic
965296919 3:166958740-166958762 ATTATCTCCATTTTACAGAGTGG + Intergenic
965797401 3:172455119-172455141 GCCAACTCCATTTTCAAGAGAGG + Intergenic
966880816 3:184349724-184349746 GTGATCCCCATTTTACAGATCGG + Intronic
966886710 3:184381058-184381080 ATTATCCCCATTTTCCAGACAGG + Intronic
967015946 3:185481710-185481732 ATCATCCCCATTTTACAGAGAGG - Intronic
967274752 3:187763325-187763347 TTTATCCCCATTTTACAGACTGG + Intergenic
967723995 3:192844595-192844617 GCTGGCCCCATCTGCCAGAGGGG - Intronic
968119232 3:196112845-196112867 TCTATTCCAAATTTCCAGAGAGG + Intergenic
969105486 4:4804337-4804359 CCTCTCCCCATTCTACAGAGGGG + Intergenic
969203463 4:5623821-5623843 ATTATCCCCATTTTACAGATAGG - Intronic
969237786 4:5878308-5878330 CCTGTCCCTATTTTACAGAGTGG - Intronic
969296689 4:6274430-6274452 GCTATCCCCATTTTACATATGGG + Intronic
969484578 4:7465024-7465046 GTCATCCTCATTTTCTAGAGAGG - Intronic
969492779 4:7509570-7509592 ATCATCCCCATTTTCCAGATGGG + Intronic
969506252 4:7589768-7589790 TTTATCCCCATTCTACAGAGAGG + Intronic
969520617 4:7675824-7675846 GCCATCCCCATTTTAGAGATGGG + Intronic
969666201 4:8558763-8558785 GCTTCCCCCATTTTGCAGACAGG + Intronic
970510582 4:16777716-16777738 GCTGTCCCCATTTTACAGATGGG - Intronic
971155110 4:24073682-24073704 ACTATCACCATTTTACAGATGGG + Intergenic
971349913 4:25846434-25846456 GTTATCCCCATTTTACAGATAGG + Intronic
971369530 4:26005280-26005302 GCTGTCCCCACTTTACAGATAGG + Intergenic
971424715 4:26504437-26504459 GTGATCCTCATTTTCCAGAGAGG + Intergenic
972359411 4:38313794-38313816 ACTATTCCCATTTTCCAATGAGG - Intergenic
972482639 4:39512120-39512142 ACTATCCTCATTTTCCAATGAGG - Intronic
974140297 4:57878164-57878186 TCTATCCCCATTTTACAGCTGGG - Intergenic
974848792 4:67381471-67381493 GCTCTCCCCACTTCCCAGACGGG - Intergenic
976207780 4:82638917-82638939 ATTATCCCCATTTTACAGATAGG + Intronic
976303589 4:83537477-83537499 GCCAACCCCCTTTTACAGAGAGG + Intronic
976378892 4:84377008-84377030 GCTTTCCCACTTTTCCACAGTGG - Intergenic
978080893 4:104590198-104590220 GTTATCCTCATTTTACATAGTGG - Intergenic
978527130 4:109678491-109678513 GCGCTCCCCATTTCCCAGATGGG + Intronic
979322966 4:119345702-119345724 ATTATTCCCATTTTCCAGATGGG - Intergenic
979470483 4:121090625-121090647 ATTATCCCCATTTTGCAGATGGG + Intergenic
980992944 4:139754309-139754331 GTTGTCCACATTTTCCATAGTGG - Intronic
981614112 4:146628534-146628556 ATTATCCACATTTTTCAGAGGGG + Intergenic
981921034 4:150085049-150085071 GTCATCCCCATTTTACAGATGGG + Intronic
983226685 4:165092050-165092072 GTTATCCCCATTTTTTAGATGGG - Intronic
983240802 4:165230351-165230373 ATTATTCCCATTTTCCAGATGGG - Intronic
983746168 4:171203074-171203096 GCTATGACCTTTGTCCAGAGAGG + Intergenic
984001339 4:174250146-174250168 ACTGTCCCCATTTTACAGATGGG + Intronic
986785641 5:11111739-11111761 GTTATGACCATTTTACAGAGGGG - Intronic
986861201 5:11928353-11928375 GAGATCCCCAGTTGCCAGAGAGG + Intergenic
988532724 5:32040479-32040501 GCGCTCCCCATTTCCCAGATGGG - Intronic
988532756 5:32040590-32040612 GCGCTCCCCATTTCCCAGATGGG - Intronic
988532781 5:32040670-32040692 GCTCTCCCCACTTCCCAGATGGG - Intronic
988532852 5:32040938-32040960 GCGCTCCCCATTTCCCAGATGGG - Intronic
990283180 5:54273662-54273684 ACTATCCTCATTTTACTGAGAGG - Intronic
990650125 5:57888766-57888788 GCTATCACAATTTTTCACAGGGG - Intergenic
991094137 5:62721394-62721416 GCTATCCTCATTTTAGACAGGGG + Intergenic
991123309 5:63041535-63041557 ATTATCCCCATTTTACAGATGGG - Intergenic
991461241 5:66861440-66861462 ATTATCCCCATTTTACAGATGGG + Intronic
991514898 5:67424619-67424641 GCTATGCCCATTTTTCAATGGGG - Intergenic
992703706 5:79366207-79366229 GTTATCCCCATTTTATAGATGGG - Intergenic
992750633 5:79857486-79857508 ACTATCCCCATTTTCCCCAAAGG - Intergenic
993387060 5:87272493-87272515 CCTATCCCCATTTTACGGATGGG - Intronic
993469247 5:88286628-88286650 GCTATGTCCATTTTACAGATGGG - Intergenic
993886069 5:93416996-93417018 ACTATCTCCATTTTACAGATGGG + Intergenic
993995000 5:94712172-94712194 GCTATCCCCATTTTATAAATGGG - Intronic
994045141 5:95299881-95299903 GCTATTTCCATTTTTCAGATAGG - Intergenic
995458145 5:112373597-112373619 CCTATCCCCATTTTACGAAGAGG + Intronic
996410796 5:123156678-123156700 GCCATCCCCATTTCCCTTAGGGG + Intronic
997363016 5:133307046-133307068 GTTATTCCCATTTTACAGATGGG + Intronic
997387466 5:133484801-133484823 GGAATCCCCATTTTACAGAAGGG - Intronic
997875743 5:137545229-137545251 GTTTTCCCCATTTTCTAGACTGG + Intronic
998059408 5:139107873-139107895 ACTACCCCTATTTTACAGAGAGG + Intronic
998069271 5:139184081-139184103 CTGATCCCCTTTTTCCAGAGAGG + Intronic
998442125 5:142171406-142171428 ACCATCTCCATTTTCCAGCGGGG + Intergenic
998459159 5:142296650-142296672 ATTACCCCCATTTTCCAGATGGG + Intergenic
998515235 5:142747738-142747760 ATTATTCCCATTTTACAGAGGGG - Intergenic
998532314 5:142896815-142896837 ACTATCCCCATTCTGCAGATGGG - Intronic
998917301 5:147028746-147028768 GATTTACCCATTTTCCAAAGTGG + Intronic
999102634 5:149038970-149038992 ATTATCCCCATTTTCCAGTTGGG - Intronic
999190286 5:149742153-149742175 GCTATCCCCATTTTACAGTTGGG + Intronic
999226242 5:150027118-150027140 GTAAGGCCCATTTTCCAGAGTGG + Intronic
999247541 5:150163206-150163228 GTTAGCCCCATTTTGCAGGGAGG - Intergenic
999696376 5:154191145-154191167 GCTCTTCCCATTTTCCGGATGGG + Intronic
999707880 5:154290664-154290686 GCTGTCTCCATTTTCCAGGTGGG + Intronic
1000038782 5:157469241-157469263 GGCATCCCCATTTTGCAGATGGG - Intronic
1000197184 5:158971160-158971182 GTTATCCCCACTTTACAGATGGG - Intronic
1000291122 5:159872493-159872515 ATTATCCCCATTTTACAGAAAGG + Intergenic
1000343726 5:160296977-160296999 CTTATCCCCATTTTACAGATGGG - Intronic
1001179393 5:169504824-169504846 ATTATCCCCATTTTGCAGATAGG - Intergenic
1001181367 5:169523698-169523720 ATTAGCCCCATTTTACAGAGAGG + Intergenic
1001257859 5:170198514-170198536 GTTATCTCCATTTTACAGATGGG - Intergenic
1001307511 5:170586075-170586097 ATTATCCCCATTTTACAGATGGG - Intronic
1001308027 5:170589983-170590005 CCCATTCCCATTTTGCAGAGGGG - Intronic
1001312465 5:170621151-170621173 AGTATCCCCATTTTGCAGATGGG - Intronic
1001335097 5:170790309-170790331 GATGTCCCCATTTTACAGAAAGG - Intronic
1001397962 5:171430044-171430066 ATTATTCCCATTTTACAGAGAGG - Intronic
1001490170 5:172149400-172149422 GACATGCCCATTTTACAGAGGGG - Intronic
1001512929 5:172336428-172336450 GCAAATCCCATTTCCCAGAGAGG - Exonic
1001691334 5:173634759-173634781 AGTATCCCCATTTTACAGAGGGG + Intergenic
1001777451 5:174339294-174339316 GCTATTCCCATTTCACAGATGGG + Intergenic
1001947154 5:175788980-175789002 TGTATTCCCATTTTACAGAGAGG + Intergenic
1002022033 5:176369596-176369618 GCTATTCCCATTTTATAGATGGG + Intronic
1002118635 5:176984300-176984322 GCACTCCCCATTTCCCAGACGGG - Intronic
1002139315 5:177129186-177129208 GTTATCCCCATCTTCTAGAAAGG - Intergenic
1002296727 5:178235501-178235523 GATATGCCCATTTTACATAGGGG - Intergenic
1003119247 6:3306471-3306493 ATTATCCCCATTTTACAGATGGG + Intronic
1004143398 6:13042846-13042868 ATTATCCCCATTTTACAGAGAGG + Intronic
1004173948 6:13322440-13322462 GTTATTCCCATTTTTCAGATGGG - Intronic
1005383285 6:25259927-25259949 GATATCCCCATTTTATAGATGGG + Intergenic
1006131181 6:31870429-31870451 GTTACCCCCATTTTACAGATGGG + Intronic
1006308019 6:33236575-33236597 GTTATCCCCATTTTACAGAGAGG - Intergenic
1006503443 6:34472956-34472978 GTTATCCCCATTTTACAGATGGG + Intronic
1006608317 6:35275817-35275839 GCTATTCCCTTTTTCCATTGCGG + Intronic
1006817572 6:36863006-36863028 GCTACTCCCATTTTGCAGACAGG - Intronic
1006943005 6:37765395-37765417 GCTAGCCCCACTTTACAGATAGG - Intergenic
1007262585 6:40574278-40574300 GCTAGCTCCATTTTACAGAAGGG + Intronic
1007474832 6:42112495-42112517 GTTATCACCATTTCCCAGATGGG - Intronic
1007760730 6:44132161-44132183 ACTATCCCCATTTTACAGGGAGG - Intronic
1007841644 6:44720867-44720889 TTTGTCCCCATCTTCCAGAGGGG - Intergenic
1008003051 6:46380737-46380759 ATTATCCCCATTTTGCAGATTGG - Intronic
1013414309 6:109911235-109911257 ATTATCCCCATTTTACAGATGGG - Intergenic
1014899156 6:126942194-126942216 GTTATCCCCATTTTACAGATGGG - Intergenic
1015920161 6:138258371-138258393 ATTATGCCCATTTTCCAGATGGG + Intronic
1016806496 6:148217484-148217506 CTTATCCCCATTTTACAGACAGG + Intergenic
1017855677 6:158348965-158348987 GCGCTCCCCATTTCCCAGATGGG + Intronic
1018076622 6:160222110-160222132 GTTATCCTCATTTTACAGAAAGG + Intronic
1021227362 7:18043759-18043781 GTTAACCCCATTTTACAGATTGG - Intergenic
1021553018 7:21892068-21892090 ACCATCCCCATTTCCCAGAGAGG - Intronic
1022140316 7:27487790-27487812 TCTAGCCCTATTTTACAGAGAGG + Intergenic
1022258087 7:28679352-28679374 GGTCTCCCCATTTCACAGAGAGG - Intronic
1022603179 7:31781227-31781249 GCTAACCCCATTTTGCAGAAGGG - Intronic
1022652573 7:32290518-32290540 GCTATCCCCATTTACTAATGAGG + Intronic
1024517917 7:50275623-50275645 ATTATCCCCATTTTGCAGATGGG - Intergenic
1025245088 7:57310910-57310932 GTTAGCCCCATTTCACAGAGGGG - Intergenic
1026300319 7:69091984-69092006 GCTCACCTCATATTCCAGAGTGG + Intergenic
1027251391 7:76400853-76400875 AGTCTCCCCATTTTCCAGAAGGG - Intronic
1027460855 7:78451623-78451645 ATTATCCCCATTTTACAGATTGG - Intronic
1027540785 7:79462372-79462394 GCTATCACCATTTTCTAAAGAGG + Intergenic
1029568237 7:101353857-101353879 CATATCCCCATTTTACAGATGGG - Intergenic
1029712301 7:102306570-102306592 CCAATCCCCATTTCACAGAGGGG - Intronic
1029993119 7:104980105-104980127 AGTATTCCCATTTTCCAGAGGGG - Intergenic
1030104932 7:105979158-105979180 ATTATCCCCATTTTACAGATGGG + Intronic
1030476456 7:110039624-110039646 TCTATACCCATTTTTTAGAGTGG + Intergenic
1031622782 7:123955262-123955284 AGTATACCCATTTTCCAGTGGGG + Intronic
1033234754 7:139629514-139629536 ACTATCCCCATTTTCCAGATGGG + Intronic
1033550992 7:142447810-142447832 GCTATTCTCATTTTACAGAGAGG + Intergenic
1034024690 7:147687944-147687966 GCTATTCCCATTTTGCAAGGAGG + Intronic
1034612438 7:152383748-152383770 GTTATCCCCATTATACAGATGGG - Intronic
1034671108 7:152859066-152859088 GCTACTCCCATTTTCCAGACAGG + Intergenic
1035470368 7:159105427-159105449 GCTGTTCCCATTTTACAGAAGGG + Intronic
1035625471 8:1067554-1067576 TCCATGCCCATTTTCCAGATGGG + Intergenic
1036016185 8:4787320-4787342 GCTGTCGCCATTATCCTGAGTGG - Intronic
1037670034 8:21006878-21006900 GCCAAAACCATTTTCCAGAGTGG + Intergenic
1037881922 8:22577806-22577828 ATTATCCCCATTTTCCACATGGG + Intergenic
1037959285 8:23084197-23084219 GCTATCCACCTTCCCCAGAGCGG + Intergenic
1038296635 8:26297652-26297674 GTTATCCTCATTTTATAGAGGGG - Intronic
1039392186 8:37190236-37190258 TCTCTCCCCATTTTACAGATGGG - Intergenic
1039792716 8:40888348-40888370 GGCATCCCCATTTTGCAGAGGGG - Intronic
1040144466 8:43972734-43972756 GATATTCCCTTTTTCCAGATAGG - Intergenic
1040144858 8:43978337-43978359 GATATTCCCTTTTTCCAGATAGG - Intergenic
1040256247 8:45675013-45675035 GATATTCCCTTTTTCCAGATAGG - Intergenic
1040916973 8:52573554-52573576 GCTCTCCCCACTTCCCAGATGGG + Intergenic
1040916986 8:52573591-52573613 GCTCTCCCCACTTCCCAGATGGG + Intergenic
1041463927 8:58140388-58140410 GCTATCCCCATTTTCCAGATGGG + Intronic
1041699335 8:60771039-60771061 GTTATCACCATTTTACAGATGGG - Intronic
1042501322 8:69512545-69512567 GTTATCCACATTTTACAGAAAGG - Intronic
1042944615 8:74142639-74142661 ATTATCCCCATTTTGCAGAACGG - Intergenic
1043419952 8:80088011-80088033 CCTCTCCCTATTTTTCAGAGGGG + Intronic
1044523272 8:93224006-93224028 GACATCCCCATTTTGAAGAGAGG - Intergenic
1045016655 8:98006633-98006655 GCAATTCCCATTTCACAGAGAGG - Intronic
1045034958 8:98169789-98169811 ATCATCCCCATTTTACAGAGAGG + Intergenic
1045495152 8:102701943-102701965 GTTATCCTCATTTTATAGAGGGG + Intergenic
1045984267 8:108230284-108230306 TCTATCCCCATGTTGCAGTGAGG - Intronic
1047026340 8:120828662-120828684 GTTGTCCCCATTTTTCAGATTGG + Intergenic
1047078112 8:121427577-121427599 GCTTACCCCATTATGCAGAGAGG - Intergenic
1047827173 8:128589506-128589528 ATTTTCCTCATTTTCCAGAGGGG + Intergenic
1048180955 8:132193747-132193769 TGTATCCCCATTTTACAGATGGG + Intronic
1048188379 8:132265040-132265062 GCTATTCCCATTTTACAGGTGGG - Intronic
1048973922 8:139660794-139660816 ACCATTCCCATTTTCCAGATGGG + Intronic
1049359528 8:142205695-142205717 GCCAACCCCACTTTCCAGATGGG - Intergenic
1050017891 9:1254619-1254641 ATTATCCCCATTTTACAGATGGG - Intergenic
1050427884 9:5530665-5530687 GCTATCCACATTTTACAGATGGG - Intronic
1050486724 9:6142233-6142255 GTTATGCCCATTTTCTAGATGGG + Intergenic
1051613181 9:18981436-18981458 CCTTACCCCCTTTTCCAGAGGGG + Intronic
1052405944 9:28060965-28060987 TCAATCCCCATTTTTTAGAGAGG + Intronic
1052432923 9:28390683-28390705 ATTATCCCCATTTTGCAGGGAGG - Intronic
1052458701 9:28734493-28734515 GTTATCTCCCTTTTTCAGAGGGG + Intergenic
1052756756 9:32550403-32550425 GTTATTCCCATTTTACAGACAGG + Intronic
1055499123 9:76885778-76885800 GTTATCCCCATTTTGCACATGGG - Intronic
1055950760 9:81727876-81727898 GTTATCCCCATTTTACAGATGGG + Intergenic
1056140171 9:83669960-83669982 GCTTTCTCCATTTTACAGATGGG - Intronic
1056910586 9:90696611-90696633 TTTATCCCCATTTTACAGATGGG - Intergenic
1057184991 9:93052521-93052543 ACCATCCCCATTTTACAGATGGG - Intergenic
1057213230 9:93212647-93212669 GCTGCTCCCATTTTACAGAGAGG - Intronic
1057694160 9:97311676-97311698 GGTAACCTCATTTTCCAGAAAGG - Intronic
1057873352 9:98734255-98734277 GCTATTCCCATTTTGCAGACAGG - Exonic
1057999518 9:99850718-99850740 GTTATCCCCATTTTACAAATGGG - Intronic
1058479317 9:105374950-105374972 ATTATCCTCATTTTACAGAGAGG + Intronic
1058533002 9:105925422-105925444 GCTATCCCTATTTTCCAGGTGGG + Intergenic
1058699924 9:107591461-107591483 GCTGTGCCCATTTCACAGAGAGG + Intergenic
1058907439 9:109493353-109493375 TCCAGCCCCATTTTACAGAGGGG - Intronic
1058923823 9:109642264-109642286 ATTATTCCCATTTTCCAGATGGG - Intronic
1058952276 9:109915074-109915096 GATCTTCCCATTTCCCAGAGTGG + Intronic
1058958835 9:109973742-109973764 ATTATCCTCATTTTACAGAGTGG + Intronic
1058986598 9:110213728-110213750 ATCATCCCCATTTTCCAGATGGG + Intergenic
1059353334 9:113681462-113681484 GTTATCCCCCTTTTACAGATGGG + Intergenic
1060156091 9:121320856-121320878 ATTATCCCCATTTTTCAGATGGG + Intronic
1060293022 9:122322002-122322024 ATTATCCCCATTTTGCAGATAGG - Intronic
1060296992 9:122349750-122349772 GCTGCCCCCATTATACAGAGGGG + Intergenic
1060660922 9:125404911-125404933 TCTACCCCCATTTTACAGATAGG + Intergenic
1060730950 9:126036750-126036772 CATATCCCCATTTTCCAGGTGGG + Intergenic
1060796320 9:126514899-126514921 CTTATCCCCATTTTACAGCGGGG - Intergenic
1061249036 9:129415808-129415830 ATTATCCCCATTTGCCAGATGGG - Intergenic
1061276490 9:129571834-129571856 ACTATGCCCATTTTACAGATGGG - Intergenic
1061300217 9:129700176-129700198 GTTATCCCCATTTTCTGGATGGG + Intronic
1061515629 9:131088313-131088335 GTTACTCCCATTTTCCAGATGGG - Intronic
1061518698 9:131104563-131104585 GGTATCCCCATTTGACAGATGGG - Intronic
1061630056 9:131866655-131866677 ATTATCCCCATTTTCCAGATGGG - Intronic
1061643830 9:131982584-131982606 GTTATCCCCATTTTACAGATGGG + Intronic
1061953932 9:133951774-133951796 GGTTTCCCCATTTTACAGATGGG + Intronic
1062030974 9:134361880-134361902 GCTGTCCCCATTCTACAGATGGG - Intronic
1062077025 9:134595056-134595078 GCCATAGCCAATTTCCAGAGTGG - Intergenic
1062415298 9:136445970-136445992 GTTATTCCCATTTTACAGAGGGG + Intronic
1185650184 X:1642008-1642030 GCTATCCCCATTACACACAGAGG - Intronic
1186358170 X:8809319-8809341 ATTATCCCCATTTTACAGAGAGG + Intergenic
1187378430 X:18778550-18778572 GCCATCCCCATTTTGCAAATTGG + Intronic
1187410704 X:19048397-19048419 GTTATCCCCATTTCACAGATAGG + Intronic
1188679632 X:32986064-32986086 ATTATCTCCATTTTACAGAGAGG - Intronic
1189346730 X:40247579-40247601 ACCATCCCCATTTTACAGATGGG - Intergenic
1190215252 X:48475735-48475757 ATTATCCCCACTTTCCAGACAGG + Intergenic
1190287050 X:48968570-48968592 GCATTTCCCATTTTACAGAGGGG + Intronic
1190311843 X:49122447-49122469 GCTATCCCCATGATCCAGAAAGG - Exonic
1190407085 X:50098944-50098966 ACTATCCCCATTTTGCAGATGGG - Exonic
1192179295 X:68906270-68906292 ACTATCCCTATTTTACAGATGGG - Intergenic
1192584728 X:72309871-72309893 GTTATCCCCATTTAACAGATGGG - Intergenic
1194971906 X:100353010-100353032 ATTATCCCTATTTTACAGAGAGG - Intronic
1195173440 X:102291610-102291632 GTTATACCCATTTTTTAGAGAGG - Intergenic
1195185425 X:102395486-102395508 GTTATACCCATTTTTTAGAGAGG + Intronic
1195230870 X:102845508-102845530 CTTATCCCCATTTTACAGAAGGG - Intergenic
1195266838 X:103189815-103189837 GCTTTCCCCACTTGACAGAGAGG + Intergenic
1195300378 X:103524460-103524482 ATTATCCCCATTTTACAGAGGGG + Intergenic
1195722918 X:107884012-107884034 TCTATCCACATTTTACAGAATGG + Intronic
1195767771 X:108314778-108314800 GCCATCCTCATTTTACAGATAGG - Intronic
1196530532 X:116781828-116781850 GCAATCCCCTTCTTTCAGAGGGG - Intergenic
1196689149 X:118540692-118540714 GCTATACCCAATTTCCATATCGG - Intronic
1196792525 X:119477159-119477181 GTTATCCCCATATTCCACATGGG - Intergenic
1196828129 X:119757155-119757177 ACTGTCCCCAGTTTGCAGAGAGG - Intergenic
1196882775 X:120213681-120213703 GGTGTCCCCTTTTTCTAGAGTGG - Intergenic
1197173661 X:123462141-123462163 GCTATTCTGATATTCCAGAGGGG - Intronic
1197690834 X:129499435-129499457 ATTATCCCCATTTTACAGAATGG + Intronic
1197725787 X:129775529-129775551 GTTATCCCCATTTTCCAGGGAGG - Intergenic
1198550285 X:137737831-137737853 GCTATTACCATTTTTCAGATGGG + Intergenic
1198681000 X:139182171-139182193 CTTATCCCCATTTTACAGATGGG + Intronic
1198954201 X:142109621-142109643 GTTATCCCCATTTTACAGATTGG + Intergenic
1200069444 X:153520625-153520647 GTTATCCCCATTTTGCATTGCGG + Intronic
1201644102 Y:16208526-16208548 TCTACCCCCATTTTCCAGAATGG - Intergenic
1201658713 Y:16376795-16376817 TCTACCCCCATTTTCCAGAATGG + Intergenic