ID: 902697523

View in Genome Browser
Species Human (GRCh38)
Location 1:18150339-18150361
Sequence CCTTCCTTACGGAGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902697511_902697523 22 Left 902697511 1:18150294-18150316 CCACGTGCTCTAAGGCCTGGGCC 0: 1
1: 0
2: 0
3: 12
4: 149
Right 902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
902697517_902697523 1 Left 902697517 1:18150315-18150337 CCTCTCTGGAAAATGGGGATAGC 0: 1
1: 2
2: 13
3: 104
4: 704
Right 902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
902697514_902697523 7 Left 902697514 1:18150309-18150331 CCTGGGCCTCTCTGGAAAATGGG 0: 1
1: 0
2: 3
3: 28
4: 263
Right 902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902697523 Original CRISPR CCTTCCTTACGGAGGCTGGG AGG Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900794812 1:4701497-4701519 CCTCCCTTACTGGGACTGGGAGG + Intronic
901733717 1:11298854-11298876 CCCTCCTGACGGAGGCGAGGAGG + Intergenic
902260027 1:15218009-15218031 CATTCCTAAAGGAGGGTGGGAGG + Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902940805 1:19799393-19799415 CCTTCCTGACGGGGGCGTGGAGG + Intronic
904302237 1:29561778-29561800 CCCTCCTTAGGGTGGCTGTGAGG - Intergenic
911091776 1:94022893-94022915 AGTTCCTGAGGGAGGCTGGGAGG + Intronic
912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG + Intergenic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
917692833 1:177486736-177486758 CCTTCCTTGTGGAAACTGGGAGG - Intergenic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
922792770 1:228319205-228319227 CCTACCTCAAGAAGGCTGGGAGG + Exonic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1068105948 10:52616537-52616559 CCTTCCTTTTGGAGGCTGTAAGG + Intergenic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1072227789 10:93386528-93386550 GGTTCCTTCCTGAGGCTGGGGGG + Intronic
1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG + Intronic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1074509445 10:114099439-114099461 CCTTCCTTCCCGAGGCAGGGAGG - Intergenic
1075141927 10:119845548-119845570 GGTTCCCTAAGGAGGCTGGGTGG + Intronic
1076252818 10:128997061-128997083 CCTTCCTTAGGGACTCAGGGAGG + Intergenic
1076674918 10:132142702-132142724 CCTCCCTTACTGAGGCTCGGAGG + Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078903948 11:15666936-15666958 CTTTCCTTACGGATCGTGGGTGG + Intergenic
1080050653 11:27855827-27855849 CCTTTCTTACCTGGGCTGGGGGG - Intergenic
1084949708 11:72657912-72657934 CCCTGCTCACAGAGGCTGGGTGG - Intronic
1100856462 12:98761852-98761874 CCCTCCTGACCCAGGCTGGGAGG + Intronic
1102233117 12:111277226-111277248 CCCTCCCTGCGCAGGCTGGGAGG - Intronic
1102446478 12:113006860-113006882 CCTTGCCTACAGAGGGTGGGTGG + Intronic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1110502826 13:76248929-76248951 CCTTCCTTTCAGAGGCTCTGAGG + Intergenic
1117677015 14:58165649-58165671 CCCTGATTACCGAGGCTGGGTGG + Intronic
1117982871 14:61359047-61359069 CCTTCAGGACTGAGGCTGGGAGG - Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1128187212 15:65652510-65652532 CCTTCCTCACTCAGGCTGAGGGG + Intronic
1132771439 16:1565619-1565641 CCTGGCTCACGCAGGCTGGGCGG + Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1137481984 16:48859451-48859473 GCTTCATCAAGGAGGCTGGGAGG - Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1139583114 16:67884831-67884853 CCCTCCCTCCGGGGGCTGGGCGG + Exonic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1140476214 16:75240362-75240384 CCTTCATTACGGTGGCACGGCGG - Intronic
1143107558 17:4537158-4537180 CCTTCCTTTCAAGGGCTGGGTGG + Intronic
1144778729 17:17797468-17797490 CCTGCCCTCCGGGGGCTGGGAGG - Exonic
1146891763 17:36510903-36510925 CCGTCCTGACAGAGTCTGGGAGG + Exonic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1151348836 17:73519584-73519606 ACTCCCCTAAGGAGGCTGGGAGG - Intronic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1151733561 17:75925080-75925102 CCTTTCCTTCTGAGGCTGGGTGG + Intronic
1152073951 17:78147410-78147432 CCTTCCTTATAGAGGCAGGTGGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1155250001 18:23945256-23945278 CTTTGCTTGCGGAGGCTGTGGGG + Intronic
1155498352 18:26464221-26464243 CCTTCCTTCTGGAGGCTCTGGGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1159988785 18:74877320-74877342 CTTTCATTGCGGAGGCTGTGAGG - Exonic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1162344708 19:10112466-10112488 CCCTCCTTCGGGAGGATGGGGGG - Intronic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1168152342 19:54455866-54455888 CTTTCCTTTCGGAGGCGGGTCGG + Intronic
1168467331 19:56613754-56613776 CCCTCCTTACAGAGGCGTGGAGG - Intronic
930234740 2:48877717-48877739 TCTCTCTTACTGAGGCTGGGTGG - Intergenic
932498471 2:72159621-72159643 CGTTCCCTAAGGAGGCTTGGAGG + Intergenic
933040478 2:77458673-77458695 CCTTCCTTGCAGAGGTTCGGTGG + Intronic
935251975 2:101271049-101271071 CGTTCCTGACGGAGGCTGGACGG - Intergenic
937939651 2:127275108-127275130 CCTTTCTTATGAAGGCTGGGAGG + Intronic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
947062247 2:226180189-226180211 CCTTTCAGAAGGAGGCTGGGGGG - Intergenic
948254571 2:236556600-236556622 CCTTCCTTCTGGAGGCTTTGGGG - Intergenic
948437824 2:237966161-237966183 TCTTCCTAAAGGAGGCTGGCGGG - Intergenic
948487428 2:238289641-238289663 CCTTTCTCACGGAGCCTGTGGGG - Intronic
948491270 2:238314858-238314880 AGATCCTTACGGAGGCGGGGAGG - Intergenic
1169578263 20:6990431-6990453 CCCTCCTTCCGGAGGCTCTGGGG - Intergenic
1170141634 20:13130743-13130765 CCATCCTAATGGATGCTGGGTGG + Intronic
1170740403 20:19050944-19050966 CGAGCCTTACGGATGCTGGGAGG - Intergenic
1176234299 20:64047222-64047244 CTTTCCTGAGGGAGGCTGGCAGG - Intronic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG + Intronic
1181083937 22:20430627-20430649 CCTTTGTTAGGGAGGCAGGGCGG + Intronic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1182412947 22:30202616-30202638 GCTTCGTTACTCAGGCTGGGTGG - Intergenic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1184876996 22:47282474-47282496 CTTTCCTTACCCAGGCAGGGGGG + Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185281926 22:49975937-49975959 CCTTCCCTAAGGAGGCCGGAGGG + Intergenic
950132145 3:10554573-10554595 CATTCCTTCTGGAGGCTGCGGGG - Intronic
954633165 3:52057651-52057673 CTTTCCCTACGGAGCCAGGGTGG + Intergenic
963103074 3:141623840-141623862 AAGTCCTTACTGAGGCTGGGCGG - Intergenic
963107385 3:141658932-141658954 GTTTCCTTACGGAGGCTTTGGGG + Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
972287585 4:37663592-37663614 GCTTCCTTACAGATGCTGCGAGG - Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
984973216 4:185209146-185209168 CCTTCCCTAAGGCGGCAGGGTGG + Intronic
986082296 5:4407728-4407750 GCTTCCTTCTGGAGGCTGTGGGG + Intergenic
987419461 5:17701690-17701712 AGTTCCTTACAGATGCTGGGTGG + Intergenic
990039570 5:51363021-51363043 CCTTCCTTATGGAAGCTTAGGGG - Intergenic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1009868266 6:69424942-69424964 CAGTCCTTCCGGGGGCTGGGCGG + Intergenic
1011797929 6:90978036-90978058 GCTTCCTTCTGGAGGCTGTGGGG - Intergenic
1015568187 6:134595269-134595291 CCTTGCCTGAGGAGGCTGGGCGG + Intergenic
1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG + Intronic
1018209786 6:161469711-161469733 CATTCCTTCTGGAGGCTGTGGGG - Intronic
1019721236 7:2572866-2572888 TCTTCCTTAAGGAGGATAGGTGG - Intronic
1022467889 7:30663634-30663656 CCTTCCCAAAGGAGGCAGGGAGG + Intronic
1022913281 7:34920811-34920833 CCCTTCTTAAGGAGGCTGGATGG - Intergenic
1030278391 7:107744074-107744096 ACTGCCTTCCGGAGGCCGGGAGG - Exonic
1034067609 7:148151980-148152002 CCTTCCTTCCGGAACCTAGGTGG - Intronic
1036762052 8:11516071-11516093 CCTTCCTTTCAAAGGCTGAGTGG - Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1041956843 8:63565761-63565783 TATTCCTGACGGAGGCTGGCAGG - Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1051212022 9:14755052-14755074 CCATGCTTCCGGTGGCTGGGTGG - Intronic
1051569876 9:18543807-18543829 CCTAACTTACTGGGGCTGGGGGG - Intronic
1054736822 9:68761575-68761597 CCTTCCTTTTGGAGGCTCTGGGG + Intronic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1057664580 9:97034905-97034927 CCTCCCTTATGGAGGGTGGTAGG - Intronic
1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG + Intergenic
1061396937 9:130348547-130348569 CCGTCCTCCCGGATGCTGGGGGG - Intronic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1192360509 X:70435812-70435834 CCATCCTTATGAAGGCTGTGGGG - Intergenic
1196809186 X:119615060-119615082 CTTTCCTTACAGAGGCCTGGAGG - Intergenic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic