ID: 902697631

View in Genome Browser
Species Human (GRCh38)
Location 1:18150910-18150932
Sequence ATGTGGTAATGGACATGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902697631_902697635 2 Left 902697631 1:18150910-18150932 CCCTGTCATGTCCATTACCACAT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 902697635 1:18150935-18150957 GCCTCCCAGCTTAGTGCCATCGG 0: 1
1: 1
2: 0
3: 7
4: 114
902697631_902697644 20 Left 902697631 1:18150910-18150932 CCCTGTCATGTCCATTACCACAT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 902697644 1:18150953-18150975 ATCGGGAAAAAAAGCAGGGGTGG 0: 1
1: 0
2: 1
3: 19
4: 270
902697631_902697637 3 Left 902697631 1:18150910-18150932 CCCTGTCATGTCCATTACCACAT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 902697637 1:18150936-18150958 CCTCCCAGCTTAGTGCCATCGGG 0: 1
1: 0
2: 1
3: 15
4: 142
902697631_902697641 16 Left 902697631 1:18150910-18150932 CCCTGTCATGTCCATTACCACAT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 902697641 1:18150949-18150971 TGCCATCGGGAAAAAAAGCAGGG 0: 1
1: 0
2: 3
3: 19
4: 187
902697631_902697640 15 Left 902697631 1:18150910-18150932 CCCTGTCATGTCCATTACCACAT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 902697640 1:18150948-18150970 GTGCCATCGGGAAAAAAAGCAGG 0: 1
1: 0
2: 1
3: 5
4: 104
902697631_902697642 17 Left 902697631 1:18150910-18150932 CCCTGTCATGTCCATTACCACAT 0: 1
1: 0
2: 1
3: 9
4: 170
Right 902697642 1:18150950-18150972 GCCATCGGGAAAAAAAGCAGGGG 0: 1
1: 0
2: 1
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902697631 Original CRISPR ATGTGGTAATGGACATGACA GGG (reversed) Intronic
902697631 1:18150910-18150932 ATGTGGTAATGGACATGACAGGG - Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904118157 1:28177316-28177338 CTGTGGTCAGGGGCATGACAGGG + Intronic
906581552 1:46939409-46939431 AGGGGATAATGGACATGATATGG + Intronic
906602167 1:47139487-47139509 AGGGGATAATGGACATGAGATGG - Intronic
907160900 1:52368172-52368194 ATATGGTAATGGGCAGGGCATGG - Intergenic
907663327 1:56413599-56413621 AGGTGGGCATGGACCTGACAGGG - Intergenic
907918094 1:58888980-58889002 ATGGGGCAATGGAGATGACTGGG - Intergenic
908208674 1:61877857-61877879 ATCAGGTAATGGTCATAACAGGG - Intronic
910683137 1:89888399-89888421 ATGTGGTAATGGATTTGAATTGG + Intronic
912753032 1:112301192-112301214 ATGAGGTAATGGATATGAGAGGG - Intergenic
914674944 1:149901003-149901025 GTGAGTTAATGGACAAGACAGGG + Intergenic
915027923 1:152850220-152850242 ATGGGGTTATGGGCATGAGAGGG + Intergenic
917296594 1:173526000-173526022 ATGTGGTCATGAATATGAAATGG + Intronic
917838804 1:178961127-178961149 ATGGGGTAATGCAGAAGACAGGG + Intergenic
920101811 1:203521652-203521674 ATGTGATAAAGGAGATAACATGG + Intergenic
920328769 1:205189000-205189022 ATGTGGTAATGGTCAAATCAGGG - Intronic
922897448 1:229111439-229111461 AGGCTGTAATCGACATGACATGG + Intergenic
923014855 1:230118925-230118947 GGGTGGTCATGGACAGGACAGGG - Intronic
1063872519 10:10433849-10433871 ATGTAATAATGGTCATGGCAAGG - Intergenic
1064035795 10:11912520-11912542 ATGGGATAAAGGACATGAGAGGG - Intergenic
1070545898 10:77452227-77452249 ATGAGGTATGGGACATGACCAGG - Intronic
1073083687 10:100875122-100875144 ATGTGGAAAGGCACATGACTGGG + Intergenic
1073171817 10:101516886-101516908 AGGTGGAAATGGACATGAGTTGG - Intronic
1077626684 11:3778433-3778455 ATGACATAATGGACGTGACATGG - Intronic
1079545131 11:21624684-21624706 CTGTGGCACTGGACATGAGATGG + Intergenic
1080056935 11:27916274-27916296 AAGTGGTAATGGAGATGGAAAGG + Intergenic
1082927348 11:58563912-58563934 AGGTGGTAATGGACATAGCAGGG + Intronic
1083397838 11:62403508-62403530 AGGTGGTGATGGAGTTGACAGGG - Intergenic
1083459830 11:62803705-62803727 AGGTGGGAAAGGAAATGACATGG + Intronic
1084744759 11:71162277-71162299 ATGTGGCAAAGGGCATCACATGG + Intronic
1085895099 11:80629494-80629516 ATGTGATAATGCACATGCCAAGG - Intergenic
1087199654 11:95332768-95332790 AAGTGGTCATGGAGATGAGAAGG - Intergenic
1088273201 11:108056785-108056807 AAGTGGGAATGGAAAAGACAAGG + Intronic
1089904827 11:122027837-122027859 AGGTGGTGCTGGACATTACATGG + Intergenic
1092489338 12:8930865-8930887 ATGTGGGCATGAACCTGACACGG + Exonic
1092650981 12:10634604-10634626 CTGTGGCAATGGGCATGACACGG - Exonic
1093897504 12:24591269-24591291 ATGTGGTAATAGACTTGTAATGG - Intergenic
1095403252 12:41839274-41839296 TTATGGTAATGGACATGACAAGG + Intergenic
1096873402 12:54608915-54608937 ACATGTTAAGGGACATGACATGG - Intergenic
1096946454 12:55413672-55413694 ATGTGGGCATGAACCTGACACGG - Intergenic
1097579847 12:61441720-61441742 ATGTGGAAATGCCAATGACAAGG + Intergenic
1097882642 12:64699950-64699972 ATGTGGAAATGGACATGTTGAGG + Intergenic
1098441092 12:70519155-70519177 TTATGTAAATGGACATGACAGGG - Exonic
1099063810 12:77947871-77947893 ATGAAGTAATTGACATAACATGG + Intronic
1101608976 12:106272993-106273015 ATTTGGTAAGGGAAATGGCAAGG - Intronic
1103260877 12:119587438-119587460 AAGTGGTAATGGAAATCAGAGGG - Intergenic
1103309808 12:119996076-119996098 ATGTGGGAAAAGAAATGACAAGG - Intronic
1105944142 13:25175471-25175493 AGGTGGGAATGGACATGAGCAGG - Intergenic
1106882706 13:34149202-34149224 ATGAGATAATGCTCATGACATGG - Intergenic
1108120313 13:47178754-47178776 ATGTAGTAGTGGAAGTGACAAGG + Intergenic
1109444397 13:62414177-62414199 AGGTGGTACAGGACATCACATGG - Intergenic
1113257490 13:108523052-108523074 ATATGGAAATAGACATTACAGGG + Intergenic
1114726292 14:24941294-24941316 ATGTGGCAAGGGCCATGATAGGG + Intronic
1115848937 14:37572057-37572079 AGGTGGTAATGGACATAAAGTGG - Intergenic
1117995841 14:61477760-61477782 ATATGGTAATGGCCTTGACCGGG - Intronic
1122107090 14:99466498-99466520 ATGTGGTATAGGACACGCCATGG + Intronic
1122254228 14:100464871-100464893 ATGAGGTAAAGGAGATGAGATGG - Intronic
1122903107 14:104790075-104790097 ATGTGGTCATTGAGATGAGAGGG - Intronic
1126913763 15:53442679-53442701 ATGTGGTAGTGGGCAAAACAAGG + Intergenic
1131056096 15:89376030-89376052 CTGGGGTAATGGAGAGGACAAGG - Intergenic
1133890184 16:9871714-9871736 ATGTGGTAATGTACATAAAGTGG + Intronic
1137902774 16:52287085-52287107 AGGTGGTAATGGATTTGATATGG + Intergenic
1138713433 16:58995039-58995061 ATGTGGCAATGAACATTGCAGGG - Intergenic
1141027841 16:80564693-80564715 ATGAGGAAATGGAGATGTCAAGG + Intergenic
1141056407 16:80819247-80819269 ATGTGGTAATGGACTGGAGCTGG + Intergenic
1143100903 17:4504182-4504204 ATGTGGCAGTGGCCAGGACAAGG - Intronic
1143263883 17:5621212-5621234 ATGTGGTCAGGGAGATGCCAGGG - Intergenic
1146364990 17:32217053-32217075 ATATATTAAAGGACATGACAAGG + Intronic
1148216078 17:45834692-45834714 AGGTGGGGATGGACATGGCACGG - Exonic
1152488231 17:80609835-80609857 ATGTGGTAATAGACTTTAAAGGG + Intronic
1154268333 18:12898029-12898051 GTCTGGTGATGGACGTGACAAGG + Intronic
1159018870 18:63126587-63126609 ACGTGGAAATGCACATGACTTGG + Exonic
1159247656 18:65830195-65830217 ATGAGGTAATGTAAATGAGAGGG + Intronic
1159931110 18:74314344-74314366 ATGAGGTCAGGGAGATGACAAGG - Intergenic
1165466492 19:35977934-35977956 ATGAGGTAAATGACAGGACAAGG - Intergenic
1166264189 19:41667311-41667333 CAGTGGTAGTGGTCATGACATGG + Intronic
925545417 2:5010539-5010561 ATGTGGGAATAGAAATGACATGG + Intergenic
928161744 2:28933156-28933178 ATGTGGAAATGCAAAGGACATGG + Intronic
928213999 2:29346212-29346234 ATGAGATAGTGGACATGAAAGGG - Intronic
928422926 2:31153624-31153646 AAGTGGTAGTGGAAATGACCAGG - Intronic
932510839 2:72288012-72288034 ATTTGGCAAGGGACATGAAATGG + Intronic
933399026 2:81767617-81767639 ATGTGGTAGTGGAGAAGGCACGG + Intergenic
938748331 2:134303346-134303368 ATTATGTATTGGACATGACAAGG + Intronic
940726094 2:157338201-157338223 GTGTTGTCATTGACATGACATGG + Intergenic
942847538 2:180444520-180444542 ATATGGGAATGGGCATGAAATGG - Intergenic
943584916 2:189726687-189726709 ATGTGATAAAGGACATTACTAGG + Intronic
947165732 2:227259948-227259970 ATGTGCTTATGGAATTGACATGG + Intronic
947671141 2:231936197-231936219 CTGTGCCAATGGACATGACCTGG + Intergenic
948253645 2:236550855-236550877 GTGTGTGAATGCACATGACACGG - Intergenic
948806577 2:240455799-240455821 TTGTGGTCCTGGACATGAGATGG - Intronic
1169273403 20:4217472-4217494 AAGTGGTCATTGAGATGACATGG + Intergenic
1172892309 20:38274899-38274921 ATGTGGCAATGGATTTGACTTGG + Intronic
1173025183 20:39301064-39301086 ATGTGGGAATGCCTATGACAGGG - Intergenic
1173905511 20:46625608-46625630 ATGTGGGAATTGACCTGAAAGGG - Intronic
1175749306 20:61484237-61484259 ACGTGGGAATGTACATGGCATGG - Intronic
1175897290 20:62344383-62344405 ATGTGGTAATGGCAATGATTTGG + Intronic
1176040216 20:63061221-63061243 ACGTGGACATGGACAGGACACGG - Intergenic
1176884773 21:14242649-14242671 ATGTGGTGATGGATATGTTATGG + Intergenic
1179002104 21:37471198-37471220 ATGTGGTGATGTAGATGAAAAGG + Intronic
1180133992 21:45848957-45848979 AGCTGGGAATGGACATGCCAAGG + Intronic
1182862723 22:33574064-33574086 ATGTGGGAAGGGACTAGACATGG + Intronic
1184199871 22:42961035-42961057 AAGTGGTAATGGCCAGGGCAGGG + Intronic
949861375 3:8508237-8508259 ATGTAGAAATGCACATGTCAAGG - Intronic
950641904 3:14353882-14353904 ATGTGGTCAAGTTCATGACAGGG + Intergenic
950910418 3:16583864-16583886 AAGTCATAATGGACCTGACAGGG + Intergenic
951109392 3:18784235-18784257 ATGTGATGGTGGTCATGACAGGG + Intergenic
952699744 3:36313686-36313708 ATATGGTAATGTAAATGAAATGG - Intergenic
952715530 3:36476230-36476252 ATGTGGGACTTGACATGAAATGG - Intronic
954307350 3:49735707-49735729 ATGGGGTACTGTACTTGACATGG + Intronic
956283760 3:67586813-67586835 AAGTAGTAATTGACATGAAAGGG + Intronic
956958956 3:74375459-74375481 ATATGTTACTTGACATGACAAGG + Intronic
957953878 3:87159311-87159333 TTGTGATTATGGACATAACAAGG - Intergenic
961828293 3:129610313-129610335 AGGTGAGAATGGACAGGACAGGG - Intergenic
962636370 3:137335824-137335846 AGGTGGGAATGGACAAGAAAGGG + Intergenic
964281446 3:155071047-155071069 ATGTGGTGATGGGCATACCAAGG + Intronic
965223054 3:165952501-165952523 ATGTGGAAATAGCCATCACAGGG - Intergenic
965286611 3:166826877-166826899 AGATGGTAATGGACATGTGATGG + Intergenic
966707969 3:182937603-182937625 ATGAGTTAATGGACATGTAATGG + Intergenic
967009880 3:185422896-185422918 AGGTGGTAATGCAAGTGACAGGG - Intronic
967197534 3:187041606-187041628 ATGTTGTACTGGAAAGGACATGG + Intronic
970059925 4:12021278-12021300 AAGTGGAAAGGGACATGGCATGG - Intergenic
972449186 4:39180151-39180173 ATGTGGTAAGGTACAGGATAGGG + Intergenic
972666509 4:41170300-41170322 ATGTGGGAATTGAGATTACATGG - Intronic
975687357 4:76930685-76930707 ATGTGGTAATGGATTTGAGTTGG + Intergenic
976443881 4:85108372-85108394 ATGTGGGAAAGGACATTTCATGG - Intergenic
977083579 4:92565041-92565063 ATGTGGGAATGGTTTTGACAAGG + Intronic
977238791 4:94541629-94541651 AACTGGTAATGGACAAAACAAGG - Intronic
985167491 4:187112525-187112547 ATGTGGTGATGATGATGACATGG - Intergenic
991291733 5:65039627-65039649 ATGTGTGAAAGGACAGGACAGGG + Intergenic
991548327 5:67808309-67808331 ATGTGGTGATGACAATGACACGG - Intergenic
994847980 5:105015000-105015022 TTGTGGTAATGGAGATGAAGAGG + Intergenic
998608328 5:143660412-143660434 ATGGGGTAATGGAAGTTACAAGG - Intergenic
999537677 5:152535366-152535388 AGGTGGTACAGGACATTACATGG - Intergenic
1001122458 5:168991774-168991796 GTATGGTAATGGACAAGCCAGGG - Intronic
1005940084 6:30554339-30554361 ATGAGCTAAAGGACAGGACATGG + Intronic
1007050778 6:38826690-38826712 ATGTTGGGATTGACATGACAAGG - Intronic
1007805766 6:44444755-44444777 ATGTGGTAATGGAAGAGACTAGG - Intronic
1009865701 6:69395140-69395162 ATGTGATATTGAACAAGACATGG + Intergenic
1011106002 6:83782365-83782387 ATATGGCAATGGACTTGAAATGG + Intergenic
1011919336 6:92552065-92552087 ATGTGAAAATGGACAAGATATGG + Intergenic
1012188367 6:96249921-96249943 ATGTGGTTATGGAAATGCCCTGG - Intergenic
1013598057 6:111678892-111678914 AGGATGTAATGGACCTGACACGG - Intronic
1014992222 6:128094962-128094984 ATGTGTTAGTGAGCATGACAGGG + Intronic
1015218431 6:130777095-130777117 ATGTTGGAAATGACATGACAGGG - Intergenic
1017546194 6:155452936-155452958 GTGAGGTAATGGACATAAAAGGG - Intronic
1019942773 7:4304307-4304329 ATGAGGGAATGTGCATGACATGG - Intergenic
1020571131 7:9863226-9863248 AATGGGTAATGTACATGACATGG - Intergenic
1020818042 7:12930282-12930304 TTGTGGTGACGGACATGATAGGG + Intergenic
1021211170 7:17854546-17854568 ATGTGACTATGCACATGACATGG - Intronic
1021274432 7:18632055-18632077 ATATGGAAATGGAAATGATATGG + Intronic
1026638990 7:72107970-72107992 TTGTGGTAATGATCATGCCAGGG - Intronic
1027780626 7:82515708-82515730 ATGTGGTAATGGATAACACAAGG + Intergenic
1029822836 7:103161127-103161149 GTGTGGTAAGAGATATGACAGGG - Intergenic
1032553307 7:132805803-132805825 ATGTGGTAACTGAGAGGACATGG + Intronic
1033793868 7:144824098-144824120 ATGTGGTAAGAGACATGTAAGGG - Intronic
1038012209 8:23484043-23484065 AGGTGGTAATGAACCTGACAGGG - Intergenic
1039306067 8:36264396-36264418 ATGAGGATATGGAGATGACAGGG - Intergenic
1040750488 8:50699976-50699998 ATATGGTAATCAACTTGACAAGG + Intronic
1044271435 8:90249178-90249200 ATGTGGTAAGGCACATGCTAGGG - Intergenic
1044317434 8:90766110-90766132 ATGAGGAAATGTACATGCCAAGG + Intronic
1046137320 8:110045120-110045142 ATGTAGCACTGGACATCACATGG - Intergenic
1047162629 8:122397740-122397762 TTGTGGTAATGGTTATCACAAGG + Intergenic
1047225359 8:122951990-122952012 TGGTGGTGATGGACACGACATGG - Exonic
1048063774 8:130947775-130947797 ATGTGCAAATGTACATGAAATGG + Intronic
1048496879 8:134942751-134942773 CAGTGGTGATGGAGATGACATGG + Intergenic
1050252769 9:3762764-3762786 ATTTGGTAATGGAAATGTTATGG - Intergenic
1050764678 9:9117422-9117444 ATGAGATAATGCACATGAAATGG + Intronic
1050959594 9:11711457-11711479 ATGTGTTTATGGAAATCACACGG - Intergenic
1052954941 9:34246533-34246555 ATTTAGAAATGGGCATGACATGG + Intronic
1053326533 9:37157624-37157646 ATGGGGTAATGGACCTGAACAGG + Intronic
1055033717 9:71795954-71795976 ATATGCTAAAGGACATGAGATGG - Intronic
1059415121 9:114157418-114157440 ATGTGTCCATAGACATGACATGG - Intronic
1060250597 9:121983830-121983852 ATGTGGTTATGGATAAGACAAGG - Intronic
1061185055 9:129048227-129048249 ATGTGGTCATGAGCAGGACATGG + Intronic
1062520319 9:136954893-136954915 ATGTGGTTATGCACATGTAAAGG - Intronic
1062598582 9:137310097-137310119 ATGTGGAAATGGACAGGTCAGGG - Intronic
1186416508 X:9387619-9387641 AAGTTGTCATGGACATGGCAGGG - Intergenic
1189160179 X:38803128-38803150 ATATGGCAAGGGACATGAGATGG + Exonic
1193837176 X:86358074-86358096 AAGTGGGAGAGGACATGACAGGG - Intronic
1194267346 X:91771248-91771270 ATGTGGAAATGAAGATGATAGGG - Intergenic