ID: 902697724

View in Genome Browser
Species Human (GRCh38)
Location 1:18151518-18151540
Sequence CACATTCTAGTGGCCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902697719_902697724 9 Left 902697719 1:18151486-18151508 CCAGGTCCAGAGTGGCATATACC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 902697724 1:18151518-18151540 CACATTCTAGTGGCCAGAGCAGG 0: 1
1: 0
2: 4
3: 33
4: 215
902697720_902697724 3 Left 902697720 1:18151492-18151514 CCAGAGTGGCATATACCATCGAC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 902697724 1:18151518-18151540 CACATTCTAGTGGCCAGAGCAGG 0: 1
1: 0
2: 4
3: 33
4: 215
902697717_902697724 25 Left 902697717 1:18151470-18151492 CCTAGAGTTTCAAGGGCCAGGTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 902697724 1:18151518-18151540 CACATTCTAGTGGCCAGAGCAGG 0: 1
1: 0
2: 4
3: 33
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902697724 Original CRISPR CACATTCTAGTGGCCAGAGC AGG Intronic
902697724 1:18151518-18151540 CACATTCTAGTGGCCAGAGCAGG + Intronic
902801260 1:18831682-18831704 CCCAGCCTAGTGGCCAGTGCTGG - Intergenic
904498981 1:30903219-30903241 CACTTTCTAAGGGCCAGAGGGGG + Intronic
905342519 1:37289088-37289110 CTCATTCGATTGGTCAGAGCAGG - Intergenic
910982116 1:92968616-92968638 CACCATCTAGTGGCCTGAGAAGG - Intergenic
911273649 1:95834173-95834195 TACATTTTATTGGCCAGAACTGG + Intergenic
913161303 1:116148347-116148369 CACACTCTAAAGGGCAGAGCTGG - Intergenic
914356431 1:146888479-146888501 CACAGTCTAGTGGAGAGAGATGG + Intergenic
915432799 1:155879553-155879575 CACATTGGGGTGGGCAGAGCAGG + Intronic
916279359 1:163032121-163032143 CACATTCTCATGGCCAGCTCTGG + Intergenic
917211401 1:172635402-172635424 CACATTTTATTGGCTAGAGCAGG - Intergenic
919878584 1:201888295-201888317 CCCCTTCAAGTGGACAGAGCTGG - Intergenic
921710740 1:218370816-218370838 CACATTCCATTAGCCAAAGCAGG + Intronic
921889983 1:220344002-220344024 CACATTCTATTGGCCAAAGCAGG + Intergenic
922004721 1:221518290-221518312 CACATTCTATTGGTCAAAACAGG - Intergenic
922026651 1:221755989-221756011 CTCATTACAGTGTCCAGAGCAGG + Intergenic
922720757 1:227899193-227899215 CACAGGGGAGTGGCCAGAGCAGG + Intergenic
923434746 1:233957178-233957200 CACAGTCTAGTTTCCAGAGTGGG + Intronic
923508976 1:234633043-234633065 CACAATCTGATGGCCAGAGGAGG + Intergenic
1065780200 10:29160202-29160224 CACACTCCTGTTGCCAGAGCTGG + Intergenic
1071317757 10:84419447-84419469 CACATTCTTTTGGCCAAAGCAGG + Intronic
1071512065 10:86268244-86268266 TCCATTTTATTGGCCAGAGCAGG - Intronic
1071556788 10:86610420-86610442 CACATCCCATTGGCCAAAGCAGG - Intergenic
1072192950 10:93090944-93090966 CCCATTCTATGGGCCAGATCTGG - Intergenic
1075835363 10:125448358-125448380 CACAAACAAGTGGCCAGAGGTGG - Intergenic
1076426849 10:130373045-130373067 CACATTCCACAGGCCAAAGCTGG - Intergenic
1076485269 10:130811582-130811604 CAGATTCTATTGGTCAAAGCAGG - Intergenic
1076878561 10:133229302-133229324 CGGATTCCAGTGACCAGAGCAGG + Intergenic
1077114001 11:874934-874956 CACACTCCTGAGGCCAGAGCCGG - Intronic
1078418876 11:11190413-11190435 CACAGTCTACTGGCCACATCTGG + Intergenic
1078641453 11:13100790-13100812 CACATTCTATTGGTCACAGCAGG - Intergenic
1081352173 11:42067056-42067078 CAGATTTTATTGGCCAGAGCAGG + Intergenic
1083742534 11:64718444-64718466 CACATTCTGGTGGCCCCAGAAGG + Intronic
1083919541 11:65774721-65774743 CACATTTCATTAGCCAGAGCTGG + Intergenic
1084105706 11:66978901-66978923 TGCATTCTATTGGCCAAAGCAGG - Intergenic
1084495699 11:69501876-69501898 CACATACAAGTGGCCATAGAAGG + Intergenic
1085327194 11:75615639-75615661 AACATTCTGGTGCCCAGAGTGGG + Intronic
1086340416 11:85843001-85843023 CAGATTCCATTGGCCACAGCTGG - Intergenic
1086577998 11:88362369-88362391 CACATACTATTGGCCAGACATGG + Intergenic
1086900411 11:92361269-92361291 CACTTTCCATTGGCCAAAGCAGG + Intronic
1087433044 11:98077958-98077980 CAGAATCTGGTGGCCAAAGCTGG + Intergenic
1089222686 11:116887777-116887799 TACATTCTAGTGGGGAGAGGAGG + Intronic
1089896752 11:121938063-121938085 TACATTCTCCTGGCCAGAGAGGG - Intergenic
1090044448 11:123318514-123318536 GACATTTTAGAGGACAGAGCTGG - Intergenic
1090251053 11:125252205-125252227 CACATCCTGGTAGCCAGAGAGGG + Intronic
1091230878 11:133987248-133987270 CACATTCTAGTGCTCAGGGTGGG + Intergenic
1091318002 11:134629222-134629244 CACATCTTTGTGGGCAGAGCAGG - Intergenic
1096845875 12:54406178-54406200 TACATTCTAGTGGGTAGAGAGGG - Intronic
1098284678 12:68895244-68895266 CACATTTCACTGGCCAGAGCAGG - Intronic
1098366822 12:69712205-69712227 CTACTTCTAGTGCCCAGAGCAGG + Intergenic
1100199726 12:92285480-92285502 CACATTCTAGTGGCCTAACGTGG - Intergenic
1100235853 12:92660215-92660237 CACATTCCATTGGCCAAAGAAGG - Intergenic
1100652584 12:96606658-96606680 CAGATTATAGTAGCCTGAGCGGG + Intronic
1100697697 12:97113528-97113550 AACATTCTAGTGGACAGTGCTGG + Intergenic
1101891652 12:108721783-108721805 CATCTTATAATGGCCAGAGCTGG - Intronic
1103323975 12:120108289-120108311 CTCATTCTGGTTGCCAGAGGAGG - Intronic
1104712031 12:130994002-130994024 CACATCTCAGTGGCCAGAGCTGG + Intronic
1105014906 12:132780626-132780648 CACCTTCTACGGACCAGAGCAGG + Intronic
1110374414 13:74776157-74776179 AAAGTTCTAGTGTCCAGAGCAGG - Intergenic
1111560339 13:89936547-89936569 CAAATTTTAGGGGCCAGAGCGGG - Intergenic
1112822572 13:103353917-103353939 CACATTCCATTGGCCACAGCTGG + Intergenic
1112901736 13:104365249-104365271 CACATTCTACTGACCAAAACAGG - Intergenic
1113089045 13:106597964-106597986 AACATCCTTGTAGCCAGAGCTGG - Intergenic
1113130763 13:107034624-107034646 CACATTCCAGGTGGCAGAGCGGG - Intergenic
1115537295 14:34385057-34385079 CAGCATCAAGTGGCCAGAGCTGG - Intronic
1115887170 14:37985471-37985493 CACAATCTAGGTGGCAGAGCTGG + Intronic
1115923178 14:38400948-38400970 GACATTCCAGGGGACAGAGCAGG + Intergenic
1117268199 14:54113111-54113133 CATATTCACATGGCCAGAGCAGG - Intergenic
1120648658 14:87103540-87103562 CATCTTCATGTGGCCAGAGCAGG - Intergenic
1120827648 14:88969922-88969944 GAAAGTCCAGTGGCCAGAGCTGG - Intergenic
1120888604 14:89471764-89471786 CACATTTTATTGGCCATAGCTGG - Intronic
1121647657 14:95530982-95531004 CAGATTCTATTGACCTGAGCTGG - Intergenic
1124235517 15:27986124-27986146 CAAATCCTGGAGGCCAGAGCTGG + Intronic
1124721528 15:32115111-32115133 CACATTCTGTTGGTCAGAGTAGG + Intronic
1125378338 15:39058605-39058627 GACATTCTAATGGCCAAAACAGG + Intergenic
1126349312 15:47728148-47728170 CTCATTCTGTTGGCCAGGGCTGG - Intronic
1126885482 15:53144567-53144589 CTCACTCTGTTGGCCAGAGCTGG - Intergenic
1128585927 15:68850083-68850105 CTCATTGTAATGGCCAAAGCAGG - Intronic
1130402867 15:83573700-83573722 CATATTCCAGGGGCCAGAGAAGG + Intronic
1130924880 15:88377698-88377720 CACATTTCACTGGTCAGAGCAGG - Intergenic
1132240247 15:100252379-100252401 CACAGCCTGGAGGCCAGAGCTGG + Intronic
1132598704 16:764530-764552 CAGATTCTCGTGGCCAGGGCAGG + Intronic
1135113835 16:19709890-19709912 CACGGTCTAGAGGCCAGAGCGGG - Intronic
1135414474 16:22258229-22258251 CACATTCCACAGCCCAGAGCTGG - Intronic
1135531246 16:23256577-23256599 AAGATTCTTGTGGCCAGAACAGG + Intergenic
1136269603 16:29140889-29140911 CACCTTCCAGTGTCCTGAGCAGG + Intergenic
1139247002 16:65454467-65454489 CAAATCATAGTGGCAAGAGCTGG + Intergenic
1139977585 16:70826984-70827006 CACAGTCTAGTGGAGAGAGATGG - Intronic
1140964774 16:79954750-79954772 CACAGCCTATTGGCCAGAGCTGG - Intergenic
1141093649 16:81147606-81147628 CACATCTCAGTGGGCAGAGCAGG - Intergenic
1142073090 16:88102157-88102179 CACCTTCCAGTGTCCTGAGCAGG + Intronic
1142138884 16:88463818-88463840 CACAGTTTTGAGGCCAGAGCTGG - Intronic
1143254123 17:5543147-5543169 CATATCCCAGTGCCCAGAGCAGG + Intronic
1143376916 17:6472415-6472437 CACACTCCTGTGGCCAGGGCTGG - Intronic
1143395822 17:6595257-6595279 CAGCTTCTAGTGGCCAGTGCTGG - Intronic
1143573225 17:7774323-7774345 CACATCCTGGGGGACAGAGCAGG + Intronic
1143681337 17:8478086-8478108 CACATTCTAGTGGAGGAAGCAGG + Intronic
1143805325 17:9421431-9421453 CAGATTATATAGGCCAGAGCAGG + Intronic
1144848272 17:18231244-18231266 CAGCTTCTAGTGACCAGGGCTGG - Intronic
1146573837 17:33974988-33975010 TACATTCTAGTGGGGAGAGATGG - Intronic
1147721850 17:42544282-42544304 CAGATTCCAGGGCCCAGAGCTGG + Exonic
1147878445 17:43638342-43638364 CACATTCTATTGGCCAAAGCAGG + Intergenic
1148191073 17:45679031-45679053 CCCATTCTAATGGCCTGAGTTGG - Intergenic
1149270314 17:54969657-54969679 CCATTTCTAATGGCCAGAGCAGG + Intronic
1149732623 17:58961660-58961682 CACTGTCTATTGGACAGAGCTGG - Intronic
1153000430 18:450462-450484 CACATCTTAATGGCCAGAGCAGG - Intronic
1153004968 18:490038-490060 CACATTCCATGGGACAGAGCAGG - Intronic
1153129151 18:1834682-1834704 CCTATTCCATTGGCCAGAGCTGG + Intergenic
1153656491 18:7287496-7287518 CACATTCTAGGTGGGAGAGCTGG - Intergenic
1158938812 18:62388372-62388394 CACATTCTGTGGGCCAAAGCAGG + Exonic
1159854413 18:73566950-73566972 CGCATTATAGTGGCAATAGCAGG + Intergenic
1160226978 18:77019175-77019197 TACATTCTAGTGGGGAAAGCAGG + Intronic
1160750958 19:734229-734251 CGCACTCTGGTGGCCAGAGAGGG + Intronic
1161805457 19:6440791-6440813 CACACACTGGTGCCCAGAGCCGG - Exonic
1163083113 19:14957679-14957701 CACATTCTAATGGGGAAAGCAGG + Intronic
1164702147 19:30293248-30293270 CACATCCTGGTGGACAGAGAGGG - Intronic
1164785739 19:30929002-30929024 CACATGCTAGTTGCCAGTGAGGG - Intergenic
1166261142 19:41642065-41642087 CGCCCTCTAGTGGTCAGAGCTGG - Intronic
925655542 2:6144199-6144221 TGCATTCTATTGGCCAAAGCTGG + Intergenic
925701950 2:6647759-6647781 GACTTTCTAGTACCCAGAGCTGG + Intergenic
926806599 2:16717093-16717115 CACATTCCAGAGGCCACACCAGG + Intergenic
927282242 2:21319184-21319206 CACATTCTAGTGACACGAGGTGG - Intergenic
927444237 2:23143667-23143689 CACATTTCATTGGCCAGAACAGG + Intergenic
932092368 2:68817725-68817747 TAAATTCTTGTGGGCAGAGCAGG + Intronic
933118910 2:78510723-78510745 CACATTCCAATGGTCAAAGCAGG + Intergenic
934018289 2:87914529-87914551 CATCTTCTAGTGGAAAGAGCTGG + Intergenic
935197387 2:100825689-100825711 CACATTTTATTGGCTAGAACAGG - Intronic
937060129 2:118974731-118974753 CCCTTTCTGGTGGCCAGAGTAGG + Intronic
938598580 2:132813671-132813693 CTCATTGTAGTTGCAAGAGCAGG - Intronic
943021876 2:182584580-182584602 CAGACACTAGTGGCCTGAGCAGG - Intergenic
944316796 2:198292939-198292961 CACATTCTGGTGGGCATAGAGGG + Intronic
945650771 2:212556692-212556714 CACATTTTATTGGTCTGAGCAGG + Intergenic
946535027 2:220618141-220618163 CACTTTCCATTTGCCAGAGCTGG - Intergenic
948785064 2:240347976-240347998 CCCAGTCAAGTGTCCAGAGCAGG - Intergenic
948862869 2:240761360-240761382 CACAGTCCAGTGGACAGAGCGGG - Exonic
1169276983 20:4240007-4240029 CACTTTGTAATGGACAGAGCAGG + Intronic
1170589592 20:17761784-17761806 CACATTCTAGTGGTGGGAGCGGG + Intergenic
1171173356 20:23034474-23034496 CACATTTTAGTGGCCAGGGATGG + Intergenic
1173692754 20:44976987-44977009 CAAATTTCAGTGGCCAGAACTGG + Intronic
1173902216 20:46599137-46599159 TACATTCTAGTGGCAAGAAATGG - Intronic
1174425150 20:50427062-50427084 CACATTTCATTGGCCAGAACTGG + Intergenic
1174560818 20:51429410-51429432 CACATTCCTGAGGCCAGAGCTGG - Intronic
1175186787 20:57184236-57184258 CACATTCCATTGGCCAAAGCAGG + Intronic
1177865852 21:26512530-26512552 TACATCCTAGGGGCCAGATCTGG + Intronic
1178715156 21:34957732-34957754 CACAATCAAATGGCCAGAGGAGG - Intronic
1179093797 21:38293336-38293358 CACACTCCATTGGCCAAAGCAGG + Intronic
1181830379 22:25555722-25555744 CACATTCTTGGGGCCAGTGTTGG - Intergenic
1181841827 22:25669845-25669867 CAGATTCTGGAGTCCAGAGCTGG - Intronic
1181891183 22:26065022-26065044 CACACGCTGGTGGCCAAAGCGGG - Intergenic
1183087238 22:35493868-35493890 CACATTCTATGGACCACAGCTGG + Intergenic
1183760282 22:39810286-39810308 CATAGTCTACTGGCCAGAGGAGG + Intronic
1183890711 22:40925963-40925985 CATATTCTAGTGGCTCAAGCAGG - Intronic
949308866 3:2673487-2673509 CACATTCTACTGATCAAAGCAGG - Intronic
950406530 3:12808544-12808566 GACATTTTTCTGGCCAGAGCAGG - Intronic
950480077 3:13238590-13238612 CACATTCCAGAGCCTAGAGCAGG + Intergenic
952496648 3:33921722-33921744 CACATTCCACTGAACAGAGCTGG - Intergenic
952535798 3:34307648-34307670 CTGATTCTGGTGGCCACAGCAGG + Intergenic
952743346 3:36755990-36756012 TACAGTCCAGTGGCCAGAGCTGG + Intergenic
954196971 3:49002708-49002730 CCCTTTATAGTGGCCAGAGATGG + Intronic
954654661 3:52186538-52186560 CAAAGCATAGTGGCCAGAGCTGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
954968255 3:54629797-54629819 AAAAACCTAGTGGCCAGAGCAGG + Intronic
955237600 3:57153541-57153563 CACATTCTAGGGGGCAGAGAAGG - Intronic
955863965 3:63362034-63362056 CACATTTTATTGGCCATAACTGG - Intronic
956039899 3:65134807-65134829 CACATCCTATTGGCCAGATTTGG - Intergenic
957898876 3:86462179-86462201 CACAGTCAAGGGGCCACAGCGGG + Intergenic
959105109 3:102056968-102056990 CATCTTCAAATGGCCAGAGCAGG + Intergenic
959581101 3:107983445-107983467 ACCATCCTAGTGGCCAGAGCGGG + Intergenic
960150522 3:114244585-114244607 CATCTTCACGTGGCCAGAGCAGG - Intergenic
960497701 3:118394925-118394947 CACACACTGGTGCCCAGAGCCGG - Intergenic
961340698 3:126215494-126215516 CACATTCCATTGGCCAGAACTGG - Intergenic
961347984 3:126277177-126277199 CACCTTCACTTGGCCAGAGCAGG + Intergenic
961467617 3:127091150-127091172 CATGTTCCAGTGGCCAGTGCAGG + Intergenic
961520121 3:127462354-127462376 CACATTCTACTGCCCAAAGCAGG + Intergenic
961706113 3:128786698-128786720 CACATTCTAGTAGGCAGGGTAGG + Intronic
962752575 3:138444688-138444710 CACCTTTTAGAGGGCAGAGCAGG + Intronic
963051696 3:141148781-141148803 CACATTCTCTTGTCCAGGGCAGG - Intergenic
964729561 3:159850704-159850726 CATCTTCACGTGGCCAGAGCAGG + Intronic
969285950 4:6201858-6201880 CACGTTTCATTGGCCAGAGCAGG + Intergenic
969631662 4:8342644-8342666 TACATTCTAGTGGGAAGAGGAGG - Intergenic
970899887 4:21146439-21146461 CAGATTCTACTGGCCAGAGCAGG + Intronic
974561191 4:63521314-63521336 CACATTCCAGAGGCCACAGGGGG - Intergenic
976039283 4:80862672-80862694 CACATCCTGTTGGCCAAAGCAGG - Intronic
976848523 4:89517693-89517715 GACCTTCTAATGGCCAAAGCTGG - Intergenic
978107143 4:104916787-104916809 CACATCCTAGTCCCCAGAACCGG + Intergenic
978156547 4:105495614-105495636 AATATTTTACTGGCCAGAGCAGG - Intergenic
980995731 4:139778022-139778044 CACTTTCTAGTAGCCAGAGAAGG - Intronic
982626996 4:157780019-157780041 CATATCTTAATGGCCAGAGCAGG - Intergenic
986099490 5:4594171-4594193 CACATTCTACTGGCTGGAGCAGG + Intergenic
987127360 5:14826917-14826939 CACATTCCATTGGCCAGAAATGG - Intronic
987877629 5:23699289-23699311 CACATTATAATGGAAAGAGCAGG + Intergenic
989298741 5:39862953-39862975 CAAATTCTACTTGCTAGAGCAGG - Intergenic
989552321 5:42750505-42750527 CACATTCTATTGGTAAAAGCAGG - Intergenic
992134815 5:73733925-73733947 CACAGTCACATGGCCAGAGCAGG + Intronic
994935927 5:106254129-106254151 CACATTCACGTGGCCAGAGCAGG - Intergenic
995014626 5:107296004-107296026 TACATTTTAGTGGCTTGAGCTGG + Intergenic
996516356 5:124373637-124373659 GACATTCTAGAGGCCACAGCAGG - Intergenic
997297948 5:132780146-132780168 TACATGCTATTGGCCAGAGCTGG + Intronic
997736010 5:136213129-136213151 CCCATCCCTGTGGCCAGAGCAGG - Intergenic
997781705 5:136666247-136666269 CACGTTCTATTGGCCAGAATTGG - Intergenic
999154122 5:149445987-149446009 CACACTCTACTGGTCAAAGCAGG + Intergenic
1000874283 5:166617312-166617334 CAAATTCCAGTGGCTTGAGCAGG - Intergenic
1001395615 5:171418170-171418192 GACATTCTGATTGCCAGAGCTGG - Intergenic
1002091233 5:176807677-176807699 CACAATCCATTGGCCAGAACTGG - Intergenic
1002551384 5:179995366-179995388 CCAATTCTAGTGCCCAAAGCTGG + Intronic
1002608723 5:180399706-180399728 CATATTCCATGGGCCAGAGCTGG - Intergenic
1004740787 6:18458538-18458560 TACATTTTCGTGGCCATAGCAGG + Intronic
1005326406 6:24705637-24705659 TACATTCTAATGACCAGAACTGG - Exonic
1006930260 6:37683535-37683557 CAAGCTCTAGTGGCCAGAGATGG - Intronic
1007290089 6:40779080-40779102 GAAACTCTTGTGGCCAGAGCAGG - Intergenic
1007794111 6:44333769-44333791 CATATTCTGTTGGCCAAAGCAGG - Intronic
1007811219 6:44487180-44487202 CACATCCTATTGGCCAAAGCAGG + Intergenic
1008656686 6:53621491-53621513 AACATTATAATGGCCAGGGCTGG + Intergenic
1011220686 6:85051665-85051687 CAACTTCCAGGGGCCAGAGCAGG + Intergenic
1013185346 6:107752776-107752798 GACATTCTAATGGCCAGCGGGGG + Intronic
1014937074 6:127397491-127397513 CACATTCCAGTGGCCACAAGGGG - Intergenic
1015954205 6:138583273-138583295 CACTTTCCACTGGCCAAAGCAGG + Intronic
1017818085 6:158029216-158029238 CACATTCCAGGGGCCAGGGGTGG - Intronic
1022884043 7:34623162-34623184 CACATTCTAGTGGGAGGAGAAGG + Intergenic
1027614027 7:80399268-80399290 CACCTTCACCTGGCCAGAGCAGG - Intronic
1028274575 7:88838641-88838663 TACATTATAGTGGTAAGAGCAGG + Intronic
1030797160 7:113803062-113803084 CACCATTTAGTGGCCAGAGTTGG - Intergenic
1031666203 7:124485533-124485555 CTCATTTTATTGGCCAAAGCAGG + Intergenic
1032797506 7:135289443-135289465 CAAATTCTAATGTCCAAAGCTGG - Intergenic
1034224294 7:149470873-149470895 CACATCCTAGTCCCCAGAACCGG + Intergenic
1034479663 7:151309482-151309504 CAGATGCTAGTGGCCAAAGGAGG - Intergenic
1035377434 7:158414697-158414719 CACATTGATGTGGCCAGGGCGGG - Intronic
1036767193 8:11556540-11556562 CCCATTCCAGGTGCCAGAGCTGG - Intronic
1038275191 8:26115515-26115537 CACATCCTACATGCCAGAGCAGG - Intergenic
1038376048 8:27041502-27041524 CATCTTCACGTGGCCAGAGCAGG - Intergenic
1052863725 9:33452665-33452687 CACATTGGAGTGGCTAGAGTTGG + Intergenic
1055448276 9:76405338-76405360 TACATTCTAGTGCCTAGTGCAGG - Intergenic
1055964211 9:81849710-81849732 CACAGTCTAGTGGGGAGACCAGG + Intergenic
1056070680 9:82983668-82983690 CATATTCTATTGGTCAAAGCAGG - Intronic
1057356115 9:94332691-94332713 CCCATCCTTGTGGCCAGAGAGGG + Intergenic
1057525064 9:95791713-95791735 CAAATTCTATTGGCCAGAACTGG - Intergenic
1057651635 9:96924937-96924959 CCCATCCTTGTGGCCAGAGAGGG - Intronic
1058573837 9:106378946-106378968 CACATTATATTGGTCAAAGCAGG - Intergenic
1058952906 9:109920184-109920206 CACATCCTATTGGCTAAAGCAGG + Intronic
1060089673 9:120731915-120731937 CACAGTCTAGTGCGCTGAGCTGG + Intergenic
1060126879 9:121055827-121055849 GACACTCTACTGGCCACAGCTGG - Intergenic
1061012191 9:127962266-127962288 GACACTCCAGTGGCCAGAGGTGG - Intronic
1062009383 9:134258981-134259003 CACATACTAGAGGACTGAGCAGG + Intergenic
1186088961 X:6023554-6023576 CACCTTCTAGCAGTCAGAGCAGG - Intronic
1188957128 X:36446826-36446848 GACATTCTACTGACCAGAGGTGG - Intergenic
1189540361 X:41981169-41981191 CACATTCCATTGGCCAGAACTGG + Intergenic
1190013447 X:46805455-46805477 CACATTCTATTGGTCAAAGCAGG - Intergenic
1192562285 X:72135048-72135070 CAACTTCTTGTGCCCAGAGCTGG + Intronic
1192710616 X:73581007-73581029 CAGATTCTAGTGACCAGAAAAGG + Intronic
1193593810 X:83421744-83421766 CATCTTCACGTGGCCAGAGCGGG - Intergenic
1195570879 X:106397454-106397476 CACTTTCACGTGGCCGGAGCAGG - Intergenic
1199126240 X:144124477-144124499 CATCTTCTAGTGGAAAGAGCTGG - Intergenic
1200291578 X:154880394-154880416 CACATTCTTATTGCCAGAGATGG + Intronic