ID: 902700281

View in Genome Browser
Species Human (GRCh38)
Location 1:18167656-18167678
Sequence CAGCAGAAGGAAAGGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 763}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902700281_902700293 23 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700293 1:18167702-18167724 ACCCTCGTGATCTGCTGGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 82
902700281_902700289 18 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700289 1:18167697-18167719 CCTCCACCCTCGTGATCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 140
902700281_902700298 26 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700298 1:18167705-18167727 CTCGTGATCTGCTGGGGTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 147
902700281_902700291 20 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700291 1:18167699-18167721 TCCACCCTCGTGATCTGCTGGGG 0: 1
1: 0
2: 0
3: 14
4: 73
902700281_902700297 25 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700297 1:18167704-18167726 CCTCGTGATCTGCTGGGGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 181
902700281_902700295 24 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700295 1:18167703-18167725 CCCTCGTGATCTGCTGGGGTGGG 0: 1
1: 0
2: 0
3: 53
4: 695
902700281_902700290 19 Left 902700281 1:18167656-18167678 CCGTCCACCCTTTCCTTCTGCTG 0: 1
1: 0
2: 3
3: 69
4: 763
Right 902700290 1:18167698-18167720 CTCCACCCTCGTGATCTGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902700281 Original CRISPR CAGCAGAAGGAAAGGGTGGA CGG (reversed) Intronic
900709768 1:4106384-4106406 GAGAAAAAGGAAGGGGTGGAGGG + Intergenic
900816583 1:4851850-4851872 CAGCAGAATTCCAGGGTGGAGGG - Intergenic
900862630 1:5244205-5244227 CAGCAACAGGAAATGGGGGATGG - Intergenic
901023379 1:6266571-6266593 CGGCAGATGGAAAGGGGGCAGGG - Intronic
901174296 1:7287466-7287488 GAGAAGAAGGAAAGGGAGAAAGG - Intronic
901328092 1:8381243-8381265 CAGTCGGAGGAAAGGGAGGAGGG - Intronic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
901876800 1:12171438-12171460 CAGCAGAAGGAAGCGAGGGAAGG - Intronic
902199105 1:14820700-14820722 GAGCAGAAGGTAAAGGTAGAAGG + Intronic
902405189 1:16178983-16179005 TAACTGAAGGAATGGGTGGATGG - Intergenic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902802344 1:18838308-18838330 CAGCAGGAGGAAAGGTGGGATGG - Intergenic
902842304 1:19082698-19082720 AAGCAGGAGGAGAGGGTGCAAGG + Intronic
903662858 1:24989321-24989343 CAGCAGAGGGGAAGGGTGGGAGG + Intergenic
904282771 1:29433051-29433073 CAGCAGAGGAGAAGGGTTGAGGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905271871 1:36792670-36792692 CTGCTGAAGGAGTGGGTGGACGG + Intergenic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
905721891 1:40210812-40210834 TAGAAGAAAGAATGGGTGGAGGG + Intronic
905913319 1:41668639-41668661 GAGCTGGAGGGAAGGGTGGATGG - Intronic
906042297 1:42797275-42797297 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
906052715 1:42888044-42888066 CAGCAGCAGGAAGGCGTTGAAGG + Intergenic
906190380 1:43895235-43895257 CAGGATAAGGAAGGGTTGGAAGG - Intronic
906280416 1:44549631-44549653 CAGCAGGAGGAAGGGGAGGAAGG - Intronic
906400580 1:45501375-45501397 CAGCAGAAGGAATGGGAAGTGGG - Intronic
906631504 1:47372834-47372856 AACCATAAGTAAAGGGTGGAGGG - Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907247045 1:53115119-53115141 GAGCAGAAAGAGAGGCTGGAAGG - Intronic
907581657 1:55577826-55577848 CAACAGGAGGAAAGGGTGGGTGG + Intergenic
908326426 1:63028262-63028284 CAGCACAGGGACAGTGTGGAGGG - Intergenic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
908466623 1:64402480-64402502 AGGCTGAAGGATAGGGTGGATGG - Intergenic
908714098 1:67052269-67052291 TAGCAGAAAGAAAGGGAGGAAGG + Intronic
908992596 1:70111230-70111252 CTGAAGAAGAAAAGAGTGGATGG - Intronic
909213131 1:72849719-72849741 AAGCAGAAGGAAAGGAAGTAAGG - Intergenic
909293703 1:73916328-73916350 CAGCAGAACAAAATGGTGGGAGG + Intergenic
909975774 1:82044747-82044769 TAGCAGAAGGAGAGAGTGTAAGG + Intergenic
911040145 1:93584753-93584775 CCACACAAGGAAAAGGTGGAAGG + Intronic
911065022 1:93780277-93780299 AAGCAGAAGGAAGAGGTAGATGG - Intronic
911202000 1:95054351-95054373 GAGCAGGAGGAAGGGGTGGAGGG - Intronic
911713925 1:101109129-101109151 TAGCAAAAGGGAAGGGAGGAAGG - Intergenic
911810273 1:102267585-102267607 AAACAGTAGGAAGGGGTGGATGG - Intergenic
912353336 1:109035362-109035384 TAGGAGAAGAAAAGGGTTGAAGG + Intronic
912359513 1:109083214-109083236 CAGCAGAAGATAATGGTGAAAGG - Intergenic
912586625 1:110772437-110772459 GAGAAGCAGGACAGGGTGGAGGG - Intergenic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
915393123 1:155562313-155562335 GAGGAGAAGGGAAAGGTGGAAGG + Exonic
915409278 1:155688219-155688241 GAGGAGAAGGGAAAGGTGGAGGG + Exonic
915640474 1:157220369-157220391 GACCAGAAGTAAAGGGTGGCAGG - Intergenic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916217733 1:162411940-162411962 CTGCTCAAGGAAGGGGTGGATGG - Exonic
916282840 1:163071779-163071801 CAGCAGAGGGAAATGGAGCATGG - Intronic
916571368 1:166030758-166030780 CAGTAAAAGGAAAGGGTGTGAGG - Intergenic
917264867 1:173210297-173210319 GTGCAGAAGGGAAGGGTGCAGGG + Intergenic
918120086 1:181530706-181530728 CAGCAGAAGGGATGGGAGGAAGG - Intronic
919479264 1:198066695-198066717 CAGCAGATAGAAAGAGAGGAAGG - Intergenic
919851222 1:201674290-201674312 CAGCAGAGAGGAAGGGTGGTGGG + Intronic
919910244 1:202106671-202106693 CAGCAGCTGGACAGGGTGGTGGG - Intergenic
919914451 1:202130892-202130914 CAGCAGGAGGGAGAGGTGGAGGG - Exonic
919927690 1:202200825-202200847 CAGCAAAAGGACATGGTGGGGGG + Intronic
920036846 1:203071654-203071676 CAGGAGAGGGAAAGGTGGGAAGG - Intronic
920149048 1:203888898-203888920 TAGCAGCAGGAAAGGCTGGAGGG + Intergenic
920297341 1:204967118-204967140 CAGGACAAGGGAAAGGTGGAGGG - Intronic
920634486 1:207686191-207686213 AAGGAGAAGGAAAGGAGGGAAGG - Intronic
921048746 1:211495854-211495876 CAGCAAAGGGGAAAGGTGGAAGG - Intergenic
921305448 1:213792098-213792120 GAGCAGGAGGAAAGGGTGGGAGG - Intergenic
921339058 1:214116272-214116294 CAGCAGAAAGAAAGGGTTGGAGG - Intergenic
921372589 1:214439934-214439956 CAGAAGAAACAAAGGGTAGAGGG - Intronic
922120027 1:222656579-222656601 AAGCAGGAGGGTAGGGTGGAAGG - Intronic
922244594 1:223783250-223783272 CTGCAGAAGGAACGTGGGGAGGG - Intronic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922783715 1:228272849-228272871 CAGCTCAGGGACAGGGTGGAAGG - Intronic
922929813 1:229380330-229380352 TTGCAGAAGGAAAGAGGGGAGGG + Intergenic
923515581 1:234695421-234695443 CTGCAGAAGGAATGGCTGGAGGG - Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1063121797 10:3109803-3109825 CTGCAGAAGGACAGAGTGCAGGG + Intronic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063917615 10:10899760-10899782 GAGCAGGAGGAAGGGGTGGTGGG + Intergenic
1064074321 10:12256752-12256774 CAGCAGGGGGGAAGGGGGGATGG + Intergenic
1064956551 10:20917420-20917442 CAACAGAAGCAAAGGGTAGAAGG + Intronic
1065118299 10:22503626-22503648 GAGGAGAAGAAAAGGATGGATGG + Intergenic
1065875062 10:29990512-29990534 GTGCAGAAGCAAGGGGTGGAGGG - Intergenic
1066271873 10:33831926-33831948 CAGTAGAAGGGTAGGGTGGGAGG + Intergenic
1066506310 10:36048445-36048467 GAGGAGAAGGAAGGGATGGAGGG + Intergenic
1067065631 10:43102555-43102577 CAGCAGGCGGAACTGGTGGAAGG - Exonic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068589473 10:58838926-58838948 TAGCAGAAGGCAAGGGAGAAAGG - Intergenic
1068830661 10:61491198-61491220 AAGGAGAAGGGAAGGGAGGAAGG + Intergenic
1068912143 10:62389668-62389690 CAGCAGAGAGGAAGGGAGGAAGG + Intronic
1069424318 10:68276451-68276473 CAGCAGGAGGAAAGAGTGTATGG - Intergenic
1070068514 10:73062129-73062151 TGACAGAAAGAAAGGGTGGAAGG + Intronic
1070360144 10:75680355-75680377 AAGAAGAAGGAAAGGGGGGATGG + Intronic
1070681607 10:78452946-78452968 CAGCAGAAGGACTGTGTGGGTGG - Intergenic
1070753822 10:78979378-78979400 CATCCGCTGGAAAGGGTGGAAGG - Intergenic
1071747738 10:88440918-88440940 CAGGAGAAAGAAAGAATGGAAGG + Intronic
1071997075 10:91160141-91160163 CAACAGATGGAAATGGAGGAAGG - Intergenic
1072727163 10:97821839-97821861 CAGGAGCAGGAAAGGGGGGCAGG + Intergenic
1072779144 10:98232953-98232975 TAACAGAAAGAAAGGGTGAATGG + Intronic
1072803806 10:98411317-98411339 CAGGAGAAGCAATGGGTGGCTGG + Intronic
1073056759 10:100708047-100708069 AAGGAGAAGGAAGGGGAGGACGG + Intergenic
1073662624 10:105493619-105493641 GAGTAGATGGAAAGGGAGGATGG + Intergenic
1074263558 10:111878118-111878140 CAGCAGAAGGTACGGAAGGAGGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075882122 10:125861761-125861783 CAGCAAAGGGAAATAGTGGATGG - Intronic
1076239924 10:128897083-128897105 CAAGAGAGGGAAAGAGTGGAAGG + Intergenic
1077233355 11:1468474-1468496 CATCAGAAGACAAGGGTGGGTGG + Intergenic
1077336936 11:2009527-2009549 CAGCAGAAAACAAGGCTGGAAGG - Intergenic
1077357339 11:2124535-2124557 CTGCAGCAGGAAGAGGTGGAGGG - Intergenic
1077445052 11:2586953-2586975 CACCACAAGGGAAGGGTGGGAGG - Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078141892 11:8699172-8699194 CAGCTGGGGGGAAGGGTGGAGGG - Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1079097513 11:17520468-17520490 CAGCAGCAGAAAAGAGGGGAAGG - Intronic
1079244075 11:18740615-18740637 CTGCAGCAGGAAAGGGTCCAGGG + Exonic
1079515609 11:21264439-21264461 CAGGAGATGGGAAGGCTGGAGGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080421507 11:32115271-32115293 AAGAAGAAGCAAAGAGTGGAAGG - Intergenic
1080821838 11:35814863-35814885 CAGCAGTAGGAAAACGAGGAGGG + Exonic
1081575775 11:44317813-44317835 TTGCAGAATGAAAGGGAGGAGGG - Intergenic
1081651872 11:44829336-44829358 CAGGAGAAGGAAGGGAGGGAAGG - Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082096816 11:48137714-48137736 GAGCAGGAGGCAAGGGTGGGAGG + Intronic
1082950182 11:58806425-58806447 CAGCATAAGGAATGGGGGAAGGG - Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1082998727 11:59272984-59273006 AAACACAAGGAAAGGGTGAAGGG - Intergenic
1083060259 11:59862486-59862508 GAAGAGAAGGAAAGAGTGGAGGG + Intronic
1083065642 11:59921419-59921441 CAGGAGAAAGAAAGAGTGAAGGG + Intergenic
1083457734 11:62790186-62790208 CAGCTGCAGGAAGAGGTGGAGGG - Exonic
1083555277 11:63621124-63621146 CAGGAGAAAGAAAGGGTGCAAGG + Intergenic
1083894223 11:65612097-65612119 CAGCAGTAGGAAATGCAGGAGGG - Intronic
1084122198 11:67076187-67076209 CAGCAGAAGGAACAGGTGCTGGG + Intergenic
1084426165 11:69085590-69085612 CAGCAGAGGAAAGGGGTGTAAGG + Intronic
1084433720 11:69126032-69126054 CAGCAGAGGCACAGGCTGGAGGG - Intergenic
1084470437 11:69356254-69356276 GAGAAGGAGGAAAGGATGGATGG + Intronic
1084618234 11:70250875-70250897 CAGAACAAGGACAGGGTGCAAGG - Intergenic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1085753980 11:79188718-79188740 GAGCAGTAGAAAAGGGAGGAGGG + Intronic
1086332048 11:85763869-85763891 CAGCAGCATCAAAGGATGGAAGG + Intronic
1087102560 11:94379796-94379818 CAGCAGTAGGAAGGGCTGTAAGG + Exonic
1087591300 11:100191656-100191678 CAGCAGGAGGATATGATGGAGGG + Intronic
1088098592 11:106129407-106129429 GAGCAGTTGGAGAGGGTGGAGGG + Intergenic
1088772253 11:113046855-113046877 CAGAAGAAAGAAAGGAAGGAAGG + Intronic
1088966140 11:114723340-114723362 GAGAAGAAGGAAAGGATGAAAGG + Intergenic
1089075433 11:115734741-115734763 CAGAGGAAGGAAGGGGTGAATGG - Intergenic
1089136811 11:116255805-116255827 CAGCAGAGGGGAAGGTTGGCGGG + Intergenic
1089164149 11:116461853-116461875 TAGGAGAAGGCCAGGGTGGAGGG - Intergenic
1089353893 11:117837429-117837451 CAGAAGCAGGGAAGGTTGGAAGG + Exonic
1089542785 11:119200379-119200401 CAGGAGAAGGAGGTGGTGGAGGG - Intergenic
1090073149 11:123561383-123561405 CAGCAGAAGGAGAGGATGAAAGG + Intronic
1090265765 11:125351932-125351954 GACCAGAAGGAAAGGGTTGCGGG - Intronic
1090350684 11:126105885-126105907 CAGCCGAAGGATAGGGTGCCTGG - Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091134910 11:133179913-133179935 GAGCAGAAGGTAAAGCTGGAAGG + Intronic
1202819920 11_KI270721v1_random:64709-64731 CAGCAGAAAACAAGGCTGGAAGG - Intergenic
1091780809 12:3213520-3213542 CAGGAGAGAGCAAGGGTGGAGGG + Intronic
1091796869 12:3302341-3302363 CAGCAGGGGGACTGGGTGGAAGG + Intergenic
1091832304 12:3558239-3558261 GAGGAGAAGGAAGGGGAGGAAGG - Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092070042 12:5624808-5624830 AAGCAGAAGGAAAGGGCGATGGG + Intronic
1092255745 12:6926050-6926072 CAGGAGAAGGAACTGGTGGTGGG + Intronic
1092655326 12:10677943-10677965 CAACGGCAGAAAAGGGTGGAGGG + Intergenic
1092670409 12:10855074-10855096 CAGGAGAAGGACTGGGTGGGGGG - Intronic
1092755781 12:11762174-11762196 CAGCATAAGGCAAGAGTGGCAGG - Intronic
1092855024 12:12665315-12665337 CAGCTGGAGGAAATGATGGAAGG - Intronic
1092966689 12:13650539-13650561 CAGCAGAAAGAAAGGGTGGCTGG - Intronic
1093092620 12:14938347-14938369 TAGGAGAAGGAAAGGGAGCATGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094413388 12:30191735-30191757 CAACAGAAGCAAAGGCTGCAGGG - Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1094822053 12:34233667-34233689 GAGCAGGAGGACAGGGTGTAAGG + Intergenic
1095148392 12:38759865-38759887 CAGCAGAAGGGAAGAGAAGAGGG + Intronic
1095227646 12:39695870-39695892 CATCTGAAGCTAAGGGTGGAGGG - Intronic
1095531498 12:43191744-43191766 GAGCAGAAGGAAATGGGGGTAGG - Intergenic
1095701982 12:45200136-45200158 CAACAGAGGGAAAGAGTGGGAGG - Intergenic
1095711433 12:45292892-45292914 CAGCAGAACAAAAGGGGGAATGG - Intronic
1096008595 12:48193249-48193271 GAGCAGAAAGAAAGGAAGGAAGG - Intergenic
1096640122 12:52987714-52987736 GAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1096740320 12:53688772-53688794 GAGCTCAAGGTAAGGGTGGAGGG - Intergenic
1097036637 12:56128748-56128770 CCCCAGATGGAAGGGGTGGAAGG - Intronic
1097971153 12:65634373-65634395 CAGCAAAAGGAAAAGGTGCATGG - Intergenic
1098299874 12:69043192-69043214 CAGCAGGTGGAGAGGGTGGGAGG + Intergenic
1098420716 12:70294209-70294231 GTGAAGAAGGAAAGGTTGGAGGG - Intronic
1098474930 12:70889752-70889774 CAGGAGAAGGAAAGGAGGCAAGG - Intronic
1099175971 12:79422569-79422591 CAGCCTAAGGAAATGGTGCAGGG + Intronic
1099567181 12:84266861-84266883 CATGAGAAGAAAAGAGTGGATGG + Intergenic
1100425079 12:94476819-94476841 AAGCAGAAGGCAAGAATGGAGGG - Intergenic
1101055055 12:100903967-100903989 CAGCAGGAGCAAAGGTTGGGAGG - Intronic
1101882469 12:108634748-108634770 CAGCAGAGGCAAAGGCTGGGAGG + Intergenic
1101901192 12:108792395-108792417 GAGGAGACGGAAAGGGAGGAGGG - Exonic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102151113 12:110689428-110689450 CAGCCTAAGGGAAGGGTGGGCGG + Intronic
1102428703 12:112864775-112864797 CAGTTTAAGGAAAGGGTAGAGGG - Intronic
1102462258 12:113107155-113107177 CTGCAGCAGGAAGGGGTGCAGGG + Exonic
1102496087 12:113320527-113320549 AAGCAGCAGGAGAGGGTGCAGGG - Intronic
1102556076 12:113727391-113727413 GAGAAGAAAGAAAGGGAGGAAGG - Intergenic
1103017866 12:117509466-117509488 CTGCAGAAGGAAGGGCTGCAAGG + Intronic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103366999 12:120390709-120390731 AAGGAGAAGGAAAGGAAGGAAGG + Intergenic
1103844460 12:123891836-123891858 CAGCAGAGGGAAAAAGTGCATGG + Intronic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104555774 12:129798691-129798713 CAGAAGAGAGAAGGGGTGGAGGG + Intronic
1104629769 12:130390757-130390779 CAACAAAAAGAAAGGGTGAAAGG - Intergenic
1104683531 12:130768866-130768888 CAGCAGACGGGAAGGGTGGGAGG - Intergenic
1105284446 13:18993116-18993138 AAGCAGAAGGAAAGGAAGGAAGG + Intergenic
1105941216 13:25149662-25149684 TAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1106568271 13:30905759-30905781 CAGCTGAAGGAAAGGCTGAAAGG + Intergenic
1106584980 13:31049028-31049050 CAGCAGAAGCCAAGGGAGAAGGG + Intergenic
1106614083 13:31310538-31310560 CAGCACCAGCAAAGGGTGGGAGG - Intronic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1107883716 13:44856178-44856200 GAGCAGCTGGAAAGGGTAGAGGG - Intergenic
1108544447 13:51478461-51478483 AAGCAGTAGGAAAGGGTTAAGGG + Intergenic
1108880599 13:55109450-55109472 CAGAGGCTGGAAAGGGTGGAGGG + Intergenic
1109149152 13:58823140-58823162 GAGCAGAAGAACAAGGTGGAAGG + Intergenic
1109341283 13:61062773-61062795 AAGCATAAGGAAAAGGTTGATGG - Intergenic
1109960815 13:69627465-69627487 TTGCAAAAGGCAAGGGTGGATGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110710064 13:78640873-78640895 AAGTAGAAGGAAATGGTAGATGG - Intronic
1111042615 13:82769948-82769970 CAGCAGCTGGAAAGGGTAGTGGG - Intergenic
1111706446 13:91755359-91755381 CAGAAGAAGGAAATGTTGGAAGG - Intronic
1112065095 13:95784355-95784377 CAGCACAGGGAAAAGGTGCAAGG + Intronic
1112688485 13:101861341-101861363 CAGAAGCAGGACAGGGTGGGTGG - Intronic
1112853647 13:103736737-103736759 CTGAAAAAGGAAACGGTGGAAGG - Intergenic
1113521426 13:110944549-110944571 CTGCAGTAGGAAAGGGTGAGAGG + Intergenic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114247454 14:20928013-20928035 TAGCAGCAGGAAAGAGTGAAGGG + Intergenic
1114536203 14:23424595-23424617 CAGGAGGAGGAAAGGGCAGAGGG - Intronic
1114671859 14:24415761-24415783 CAGGAGAAGGAAAGGGAGACAGG - Exonic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1117951065 14:61083079-61083101 GAGCAGGAGGAAATGGTAGAGGG - Intronic
1118381220 14:65219187-65219209 CAGAAGGAGGAAGGGGTGGTGGG - Intergenic
1118723269 14:68609052-68609074 CAGGAGAAGGAACAGGTGAAGGG - Intronic
1118946150 14:70389296-70389318 TGGGAGAAGGAAAGTGTGGAAGG - Intronic
1119387272 14:74265573-74265595 CAGCACAAAGGAAAGGTGGAGGG + Intergenic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1119878748 14:78082696-78082718 GGGCAGAAGGAAAGGATGGCTGG - Intergenic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120325106 14:83014046-83014068 CAGAAGAAGGGAAGGGGAGAGGG + Intergenic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1120746973 14:88160875-88160897 CAGAAGAAAGGAAGGGTGGATGG - Intergenic
1120868862 14:89319312-89319334 TAGCAGAGGGAAAAGGTGCATGG + Intronic
1121869389 14:97393247-97393269 CAGCAGAAAGAAAGAATGGAGGG - Intergenic
1121878435 14:97476815-97476837 CAGCAGCAGAAATGGGTGTATGG + Intergenic
1122044207 14:99011849-99011871 CAGGAGAAAGAATGGATGGAAGG + Intergenic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122242643 14:100379032-100379054 GAGCACAGGGAAAGGGTGCAGGG + Intronic
1122275026 14:100586933-100586955 CGGCGGAAGGAAAGGAGGGACGG - Intronic
1122806726 14:104263462-104263484 CACCTGAAGGACAGGGTGGGGGG + Intergenic
1123460242 15:20463782-20463804 CAGCAGAGGGCAAGGTTGGTAGG + Intergenic
1123657820 15:22536635-22536657 CAGCAGAGGGCAAGGTTGGTAGG - Intergenic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1124266463 15:28239511-28239533 CAGCAGAGGGCAAGGTTGGTAGG + Intronic
1124311729 15:28631833-28631855 CAGCAGAGGGCAAGGTTGGTAGG - Intergenic
1124847813 15:33309389-33309411 CAGGAGAAGAAAAGAGTGGATGG + Intergenic
1125181392 15:36883909-36883931 CTGCAAAAGGAAAGGGAGGGGGG + Intergenic
1125349274 15:38750842-38750864 GAGCAGAACAAAAGGGTGAATGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126557356 15:50004141-50004163 CAGCAGAGGGACAGGGAGAAGGG - Intronic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127328439 15:57916986-57917008 GGGGAGAAGGAAAGCGTGGAGGG + Intergenic
1128137237 15:65272934-65272956 AAGCAGAAGGAAAGGTTGCCAGG - Intronic
1128513352 15:68327018-68327040 GAGCAGAAGGAAGAAGTGGAGGG + Intronic
1128675079 15:69602600-69602622 TAGCAGAGAGAGAGGGTGGAGGG - Intergenic
1128954122 15:71921463-71921485 CGGGAGAAGGAGTGGGTGGAAGG - Intronic
1129182577 15:73886506-73886528 CCACAGAAGGGAAGGGTGCAGGG + Exonic
1129230178 15:74192686-74192708 CAGGGGAAGGAAAGGCTTGATGG - Intronic
1129467419 15:75731785-75731807 GAGCAGAAGGAACGGGAGGGCGG - Intergenic
1129599987 15:76993245-76993267 CTGCAACAGGTAAGGGTGGAAGG + Intergenic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130167158 15:81473212-81473234 CAGGAGAAGAAAAGGGTCCAGGG - Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131701627 15:94942985-94943007 GAGGAGGAGGAAAGGGAGGAGGG + Intergenic
1132361226 15:101217599-101217621 GTGCAGAAGGAAGGGATGGAGGG + Intronic
1133116372 16:3580048-3580070 CTCCAGAGGGAAAGGGTTGAAGG - Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133787218 16:8982900-8982922 CAGCAGGAAGAAAGGAAGGAAGG + Intergenic
1134479163 16:14602668-14602690 CATCAGGAGGGAAGGGTGGGAGG + Intronic
1134663056 16:15998579-15998601 GAGCAGAAGGAAGGGAAGGAAGG - Intronic
1134868838 16:17633138-17633160 GAAAAGAAGGAAAGGATGGAGGG + Intergenic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1135165512 16:20135524-20135546 TTGCAGAAGGACAGGGTAGAAGG - Intergenic
1135234289 16:20741442-20741464 CGGGAGGAGGGAAGGGTGGAGGG - Intronic
1135670036 16:24367480-24367502 CAGCAGAAGGCAAGGGGAGCCGG - Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136067513 16:27768828-27768850 CTGCAGAAAGGAAGGGAGGAAGG - Intronic
1136242362 16:28951932-28951954 CAGATGGAGGAAAGGGTGAAGGG + Intronic
1136366388 16:29811107-29811129 GCGCAAAAGGAAGGGGTGGAGGG - Exonic
1136409406 16:30067374-30067396 CAGGAGACAGAATGGGTGGAGGG + Intronic
1136511227 16:30739255-30739277 AAGCAGAAGGAATGCGAGGACGG + Exonic
1136588955 16:31205604-31205626 CAAAAGAAGGAAAGGAGGGAAGG - Intergenic
1136704657 16:32176957-32176979 CAGCAGAGGGCAAGGTTGGTAGG + Intergenic
1136763256 16:32752449-32752471 CAGCAGAGGGCAAGGTTGGTAGG - Intergenic
1136804844 16:33117937-33117959 CAGCAGAGGGCAAGGTTGGTAGG + Intergenic
1137348251 16:47685037-47685059 CAGAAGAAAGAAAATGTGGAAGG - Intronic
1137811854 16:51359935-51359957 CTACAGAAGGACAGGGTGGGAGG - Intergenic
1138642938 16:58400225-58400247 TAGCAGAGGGAAAGGTTGCATGG + Intronic
1140683040 16:77404044-77404066 AAGCAGAGGAAAAGGGAGGAAGG - Intronic
1141562711 16:84880084-84880106 GTGGAGGAGGAAAGGGTGGAGGG - Intronic
1142039365 16:87882708-87882730 CTGCTGAAGGACAGGGTGTACGG - Exonic
1203065407 16_KI270728v1_random:1012771-1012793 CAGCAGAGGGCAAGGTTGGTAGG - Intergenic
1143014981 17:3886939-3886961 CAGCAGACAGGAAGGATGGAGGG - Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143402200 17:6653599-6653621 CAGCAAATACAAAGGGTGGATGG + Intergenic
1143862662 17:9902130-9902152 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1143927721 17:10387325-10387347 GGGCACAAAGAAAGGGTGGAGGG - Intergenic
1144161136 17:12559340-12559362 TAGAAGAAGGAAAGAGAGGAAGG - Intergenic
1144521709 17:15957031-15957053 CAGCTGAAGGAAGGAATGGACGG + Intronic
1144620700 17:16816679-16816701 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1144884942 17:18451468-18451490 CAGGAGAAGGAAAAAGGGGAGGG - Intergenic
1145147279 17:20492909-20492931 CAGGAGAAGGAAAAAGGGGAGGG + Intergenic
1146017499 17:29245638-29245660 CAGCAGTAGGAAGGGGAAGAAGG - Intergenic
1147262154 17:39214869-39214891 CAGGAGAGGGAAAGGGTGAGAGG + Intronic
1147501966 17:40974493-40974515 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147501980 17:40974551-40974573 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1147584757 17:41647860-41647882 CAGCAGCAGAAAAGGATGCATGG + Intergenic
1147645048 17:42028272-42028294 CAGCAGCAGGAAGGGGTTGCAGG + Intronic
1147818613 17:43228442-43228464 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1147831896 17:43303144-43303166 CAGCAGAAAGAACAGGTGCATGG - Intergenic
1147995971 17:44360718-44360740 CAGCAGTTTGAAAGGGAGGATGG + Intronic
1148147790 17:45376891-45376913 CAGCAGCAGCCAAGGGTTGAAGG - Intergenic
1148607521 17:48941514-48941536 CAGCCGACAGAAAGGCTGGATGG + Intronic
1148948648 17:51288797-51288819 CAGCAAAGGGAAAGGGTACATGG + Intronic
1149450787 17:56748409-56748431 CAGCAGGAGGGAAGGCAGGAAGG - Intergenic
1149533879 17:57417099-57417121 CAGCTGAGGGAAAGGATGGGAGG - Intronic
1149786674 17:59441297-59441319 CAGGAGATGGAGTGGGTGGAAGG + Intergenic
1150178848 17:63092669-63092691 GAGCAGGAGCAAGGGGTGGAGGG + Intronic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1151111403 17:71682343-71682365 CAGCAGTAGGATAGGGAAGAAGG - Intergenic
1151403500 17:73871679-73871701 CAGCAGCAAGGAAGGGTTGAGGG + Intergenic
1151594052 17:75066058-75066080 CAGTAAAATGAAAGGGAGGAGGG - Intergenic
1151630810 17:75309614-75309636 AAGCAGAGAGAAAGGCTGGAGGG - Intergenic
1152034147 17:77861675-77861697 CAGATGAATGAATGGGTGGACGG + Intergenic
1152233028 17:79124525-79124547 CAGCAGCAGCAAGGGCTGGAAGG + Intronic
1153749155 18:8211309-8211331 CAGCATCAGAACAGGGTGGAAGG + Intronic
1153836867 18:8971195-8971217 CAGCAGCAGACAAGTGTGGACGG - Intergenic
1153979386 18:10296411-10296433 CAGCAGGAGAAAGGGGTGCATGG - Intergenic
1154125938 18:11691819-11691841 CAGCTGCACGAAAGGGTGGCGGG + Intronic
1154349684 18:13572577-13572599 CCGCAGAAGGAAAGCAGGGAAGG + Intronic
1154374609 18:13798813-13798835 CCGCAGAAGCCAAGGGAGGAGGG - Intergenic
1155167060 18:23240136-23240158 CAGCGGCAGGAAATGATGGAAGG + Intronic
1155358143 18:24973515-24973537 TGGTAGAAGGGAAGGGTGGAGGG - Intergenic
1155542514 18:26883203-26883225 GAGCAGGATGAACGGGTGGAGGG + Intergenic
1156016884 18:32556421-32556443 CAGGAGAAAGAAAGCGTGAAGGG - Intergenic
1156353656 18:36322600-36322622 CAGCAGAAGGAATGACTGGCTGG - Intronic
1156541245 18:37912990-37913012 CAGCAGGAGAAAAGAGTGAAGGG - Intergenic
1157165826 18:45357595-45357617 AAGAAGAAGGAAGGGGAGGAAGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157592913 18:48846552-48846574 CAGATGAATGAAAGGATGGATGG + Intronic
1157593113 18:48847998-48848020 CCGCAGAGGCACAGGGTGGATGG + Intronic
1158427366 18:57352341-57352363 GAGTAGAGGGAAATGGTGGAGGG - Exonic
1158669070 18:59458237-59458259 AAGAGGAAGGAAAGGTTGGATGG - Intronic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159150632 18:64518742-64518764 AAGGAGAAGGAAAGGAAGGAGGG - Intergenic
1159304606 18:66624689-66624711 CAGAAAATGGAAAGGATGGAGGG - Intergenic
1159372823 18:67551035-67551057 TAGCTGCAGGCAAGGGTGGAGGG + Intergenic
1159576320 18:70182482-70182504 CAGCAAAAGGGAAGGGAGGAAGG + Intronic
1159815651 18:73071137-73071159 AAGCAGAAGAAAAGGGTGTTTGG + Intergenic
1159895377 18:73991157-73991179 CAGCAGAAGGGAAGAGAGGGTGG - Intergenic
1159971953 18:74666136-74666158 CCGCAGAAGCATAGGTTGGAGGG + Intronic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160392640 18:78546888-78546910 AAGCAGGAGGATAGGGTGGATGG + Intergenic
1160693231 19:469869-469891 GGGCAGAAGAAAAGGCTGGAAGG - Intronic
1160960164 19:1717365-1717387 CAGGAGGATGAATGGGTGGATGG + Intergenic
1161085422 19:2332908-2332930 GAGCAGAAGGAAGGTGGGGATGG + Intronic
1161124862 19:2550165-2550187 CAGCAGAAGGAGCGGCTGGGAGG + Intronic
1161618738 19:5287154-5287176 CAGCAGAAGCAAAGGCTTGGAGG - Intronic
1161658258 19:5529454-5529476 CATCAGAAGGATGGGGTGGGAGG + Intergenic
1161789857 19:6353355-6353377 CAACAGAGGGAAAGAGTTGAAGG - Intergenic
1161994945 19:7706272-7706294 GGGGAGAAGGAAAGGGTGCAGGG + Intergenic
1163078185 19:14915257-14915279 AATAAGAAGGAAAGTGTGGACGG - Intergenic
1163214782 19:15868434-15868456 AAGAAGAAAGAAAGGGAGGAGGG + Intergenic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1164576157 19:29406482-29406504 CAGAAGCAGGGAAGGGTGGGAGG + Intergenic
1164916743 19:32058168-32058190 CAGAAGAAAGAAAGGAGGGAAGG - Intergenic
1165144417 19:33722220-33722242 GAGCTGAATGAATGGGTGGATGG + Intronic
1166042617 19:40212945-40212967 CTGCAGAAGGAGCGGGTGGGAGG + Exonic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166123608 19:40700455-40700477 GGGCAGAAGGAAAGGGAGGAAGG + Intronic
1167118022 19:47499375-47499397 GAGCAGAAGGAAAGGCTTGGCGG + Intronic
1167417990 19:49386969-49386991 GAGCAGAAGGGAAGGGAGGCGGG + Intergenic
1168112542 19:54201627-54201649 CAGCAGAGGGATGGGGTGCAGGG + Intronic
1168352468 19:55684557-55684579 GAGCAAAAGGACAGGGCGGAGGG - Intronic
1168515954 19:57010348-57010370 CAGCTGAAAGACAGGATGGATGG + Intergenic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925020485 2:564203-564225 CAGAAAAAGGAAAGGTGGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925704699 2:6673367-6673389 AAGCAGAAGGAAAAGGAGAAGGG + Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
926183252 2:10664924-10664946 CAGGAATAGGACAGGGTGGAAGG + Intronic
926309007 2:11661007-11661029 CAGGAGAGGGAAGGGGTGGGAGG - Intronic
927241644 2:20924657-20924679 CAGGAGCAGGGTAGGGTGGAGGG + Intergenic
927442298 2:23127839-23127861 GAGCAGATGGAATGGGTGTATGG - Intergenic
927503768 2:23599954-23599976 CTGCAGAATGAAAAGGGGGATGG - Intronic
927576876 2:24207818-24207840 CTGCAAAGGGAGAGGGTGGATGG + Intronic
928684860 2:33738554-33738576 GACTAGAGGGAAAGGGTGGAAGG - Intergenic
929146219 2:38709049-38709071 GAGCAGGAGGACAGGGTGTAAGG + Intronic
929545688 2:42854211-42854233 CAGCCGCAGGGAAGGGTGAAGGG - Intergenic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
929805609 2:45142461-45142483 CAGCAGAAGGGATCGGTGGAAGG - Intergenic
930303853 2:49652880-49652902 CAGCAGAAGTAAAATGTGTAGGG + Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
931699624 2:64899071-64899093 CACAAGAAGGAAAGGGTAAAGGG + Intergenic
931982397 2:67707946-67707968 CAGCAGAGGGAAAGGGGGAAAGG - Intergenic
932125422 2:69141227-69141249 ACGTAGAAGGAAAGGGAGGATGG + Intronic
932187778 2:69713715-69713737 CAGCAGAAGCAATGGAAGGATGG - Intronic
932814327 2:74849683-74849705 TAGAAGAAAGAAGGGGTGGAAGG + Intronic
933121057 2:78539004-78539026 CTGGAGAAGGAAATGATGGAAGG + Intergenic
933632240 2:84671642-84671664 AAGCAGCAGGAAGGGGTGGGGGG - Intronic
934906960 2:98213454-98213476 GAGCAGCAGGAATGGGAGGAGGG + Intronic
935659718 2:105455805-105455827 CAGGAGAGGCAAAGGCTGGAGGG - Intergenic
935874761 2:107494606-107494628 GAGAAGAGGGAAAGGGAGGAAGG + Intergenic
936395578 2:112125697-112125719 GAGGAGAAGGAAAGGAAGGAAGG + Intergenic
937512017 2:122606569-122606591 AAGCAGAAGGAAAGCCTGGCTGG - Intergenic
937625476 2:124038719-124038741 CAGAAGAAGGGCAGGCTGGATGG - Intronic
937857154 2:126680691-126680713 CAGCCCAGGGAAAGGGTGAAAGG + Intronic
938090309 2:128426833-128426855 CAGCAGGAGGAGAGGATGGGGGG + Intergenic
938397949 2:130964322-130964344 GAGGAGAAGGAAAGGCAGGAGGG - Intronic
938779403 2:134571653-134571675 CGGCAGAAGGAAAAGGTGCATGG + Intronic
938823072 2:134978052-134978074 CTGGAGAAGGGAAGGGAGGAAGG - Intronic
938889182 2:135685295-135685317 CACAAGAAGGAAAGTGAGGAAGG - Intronic
938974623 2:136464067-136464089 TAGCAGAAACAAAGGGTGAAGGG - Intergenic
939125510 2:138172947-138172969 GAGCAGGAGGAAAGGGGGCAGGG - Intergenic
939240887 2:139558744-139558766 CAGCAGTTGGAAAGGGTTGTAGG + Intergenic
940337751 2:152546596-152546618 CAGCAGAAGCAAAGGCTGCAGGG + Intronic
940696406 2:156984730-156984752 GAGGAGAAGGAAGGGGAGGAGGG + Intergenic
940745186 2:157559856-157559878 CAGCAGGAAGAAAAGGGGGAAGG + Intronic
942211623 2:173676988-173677010 GACCAAAAGGAAAGAGTGGAGGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943202764 2:184850058-184850080 CAGCAGCAGGGAAGGGTAGTAGG + Intronic
943539008 2:189188056-189188078 CAGCAGAATGAGAGGGTGAGTGG - Intergenic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
944037477 2:195312845-195312867 GAGCAAGAGGAAAGGGAGGAGGG + Intergenic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946368709 2:219267018-219267040 CAGCAGATGGGCAGGGTGGAGGG - Intronic
947702484 2:232246130-232246152 CAGCAGAAGAGCAGGGAGGATGG + Intronic
947818534 2:233054533-233054555 CAGAACAGGGAAGGGGTGGAGGG + Intergenic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948205435 2:236160571-236160593 GAGGAGAAGGAATGGGGGGAGGG + Intergenic
948219749 2:236260261-236260283 CAGGAGAAGGCAAGAGTCGAGGG - Intronic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948717327 2:239873773-239873795 CAGCACAGGGAAAGGATGGTGGG + Intergenic
948741972 2:240054118-240054140 CTGAACAAGGACAGGGTGGATGG - Intergenic
948936727 2:241170294-241170316 CAACAGAAGGAAATGTTGGATGG + Intronic
1168803066 20:655882-655904 AAGCAGAAGTAAGGGGTGGGAGG - Intronic
1169010704 20:2247701-2247723 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
1169538667 20:6576194-6576216 CCGCAGAAGAGAAGGGTGCAAGG - Intergenic
1169593764 20:7175293-7175315 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
1170609008 20:17896164-17896186 GGACAGAAGCAAAGGGTGGAAGG - Intergenic
1170764653 20:19279688-19279710 CAGCAATAGGGAAGGGTGGGAGG - Intronic
1172991611 20:39040907-39040929 CACGAGAAGGACAGGGTGGCAGG + Intergenic
1173225120 20:41158034-41158056 CAGCTGGAGGACAGGCTGGAGGG + Intronic
1173284733 20:41659937-41659959 CAGCAGAGGGGAAGGATGAAAGG - Intergenic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173564922 20:44031789-44031811 CAGCAGAAGTGGAGGGTGAAGGG + Intronic
1173899591 20:46577510-46577532 ACGCAGCAGGTAAGGGTGGATGG + Intronic
1174489625 20:50883743-50883765 CAGCAGTAGGAGTGAGTGGAGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174533521 20:51233350-51233372 CACCAGTAGGCAAGGGTTGAGGG - Intergenic
1175163748 20:57028613-57028635 CAGATGAATGAATGGGTGGATGG - Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175378955 20:58549364-58549386 CAGAGGAAGGGAAGGGGGGAAGG - Intergenic
1175559272 20:59905885-59905907 CAACAAAAGGAAAGGAGGGAGGG + Intronic
1175570369 20:60014456-60014478 CAGCAGCTGGGAAGGGTGGGGGG - Intronic
1175709319 20:61206450-61206472 CAGCAGAAGAACAGGAAGGAAGG + Intergenic
1175788734 20:61728294-61728316 TAGCAAAAGCATAGGGTGGAAGG + Intronic
1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG + Intergenic
1176872566 21:14095534-14095556 GAGCAGGAGGACAGGGTGTAAGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177579650 21:23004546-23004568 CAGCTTAAGGAATGGGTGCATGG - Intergenic
1178073320 21:28992927-28992949 CAGCAAATGGACAGGGTGGGTGG - Exonic
1178884732 21:36476229-36476251 TGGCAGAAGGCAAGGGTGCAGGG - Intronic
1179236725 21:39554093-39554115 GAGCAGAAGGAAGAGGAGGAGGG - Intergenic
1179507291 21:41850283-41850305 CACCAGGAGGAAAGTGTGGGGGG - Intronic
1179836088 21:44034418-44034440 CTGCAGAAGGCAAGGGAGAAGGG + Intronic
1180223648 21:46376082-46376104 CTGCAGACGGAGAGGGTAGAGGG - Intronic
1180231111 21:46427118-46427140 CAGCAGCAGGAAAAGAGGGAAGG + Intronic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182411494 22:30190615-30190637 AAGCAGAAGGAAATGAGGGAAGG + Intergenic
1182511611 22:30824201-30824223 CAACAGAAGGATAAGATGGAAGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1184043465 22:41957999-41958021 CTGCAGAGGGATAGCGTGGAGGG - Intergenic
1184468030 22:44680382-44680404 TAGTGGAAGGAAAGGGGGGATGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184897686 22:47421198-47421220 CAGGAGATGGAAAGTATGGAAGG - Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185377492 22:50488949-50488971 CTGCAGAAGGACAGGAGGGACGG - Intronic
949706664 3:6826213-6826235 CACCTGAAGGAAAAGGGGGAGGG + Intronic
949787953 3:7762249-7762271 CAGCAGAAGGAAAGGGCGTGGGG - Intergenic
950104173 3:10377821-10377843 CAGCAGCTGGAGAGGGTGCAGGG - Intronic
952201348 3:31131353-31131375 AAACAGTAAGAAAGGGTGGAAGG + Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952800533 3:37286721-37286743 AAGCAGAAGGAAAGCATAGAAGG - Intronic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953415368 3:42712600-42712622 CAGCAGCAGGAAGGGGAGAAGGG - Intronic
953700958 3:45195407-45195429 AAAGAGAAGGAAAGGGAGGAAGG - Intergenic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954628590 3:52036172-52036194 CAGCTGGAGGACAGGGGGGATGG - Intergenic
955153224 3:56389715-56389737 CAGCAGAATCAAAGGGTAGATGG - Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955393681 3:58539443-58539465 CAGCAGAAGGAATTGGAGGTTGG + Intergenic
955445271 3:59003234-59003256 CAACAGATAGAATGGGTGGATGG + Intronic
955849192 3:63201888-63201910 CAGTAGAAAAAAAGGGGGGAAGG - Intergenic
955947702 3:64210927-64210949 CAGAAGAATGAAAGTGGGGAAGG + Intronic
955990547 3:64622378-64622400 AAGCAGAAGAAAAGGGTGGTGGG + Intronic
956012095 3:64842801-64842823 CTTTAGAAGGAAAAGGTGGAAGG + Intergenic
956493445 3:69798841-69798863 TAGGAGAGTGAAAGGGTGGAAGG - Intronic
956612283 3:71135987-71136009 CAGGAGAAGGAAAGGCAGAACGG - Intronic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957867978 3:86049689-86049711 TAGCAGAAGGCAAAGGGGGAAGG + Intronic
958802904 3:98777139-98777161 CAGGAGGAGGAAAGGGCGAAGGG + Intronic
959401063 3:105902948-105902970 CAGAAGATGGAAAGGGGGAAAGG - Intergenic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
961191709 3:124967931-124967953 CTGCAGCAGGGAAGGGTGGCTGG - Exonic
961725642 3:128927311-128927333 AGGCAGAAGGAAAGGAAGGAAGG + Intronic
962518340 3:136174571-136174593 GAGCAAAAGGAAGGGGAGGATGG + Intronic
962805289 3:138922814-138922836 CAGCAGGAGGTAAGTGTGGCAGG - Intergenic
962891094 3:139673767-139673789 TAGAAGAAAGAAAGGGAGGAAGG + Intronic
963790300 3:149576361-149576383 CAGCAGAGTGAAAGAGTGAATGG - Intronic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
965052974 3:163675300-163675322 AAGCAGTAGTAAAGGGTAGAGGG - Intergenic
965222807 3:165950028-165950050 CACCAGAAGGCAAGTGTGGCTGG - Intergenic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966365239 3:179178736-179178758 CAGCAAAGGGAAAAGGTGAATGG + Intronic
966491310 3:180531424-180531446 CTGCAGCAGGGAAGGGTGGCTGG + Intergenic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
967679160 3:192339491-192339513 CAGCAGATGGAAAGGGTGACAGG - Intronic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
967950363 3:194835716-194835738 CAGGAGAAAGAAAGGCTTGATGG + Intergenic
968189843 3:196659870-196659892 CAGGAGAGGGTAAGGCTGGAGGG - Exonic
969290483 4:6235881-6235903 CAGGAGAAGGACAGCGTGCAGGG - Intergenic
969415176 4:7053230-7053252 CGGCAGAAGGAAAAGATTGAGGG + Intronic
969530009 4:7725374-7725396 CAGCAGAAGGAACCAGTGTAGGG + Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970704433 4:18783148-18783170 CAGCAGAAGGTAATGTTGCAAGG - Intergenic
971194725 4:24461769-24461791 AGGCAGAAGGAAAGTGTAGAAGG - Intergenic
971878019 4:32329152-32329174 CATCAAAAGGAAAAGGTGTATGG + Intergenic
972217808 4:36916659-36916681 CAGAAGAGGGAAAGGGGGGTTGG - Intergenic
972278897 4:37584689-37584711 CAGCAGAAGGCGGGGATGGAGGG + Intronic
972651107 4:41018547-41018569 CAGCAGGAGGAATGAATGGAAGG + Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973268901 4:48240379-48240401 CAACACAAGAAAAAGGTGGATGG + Intronic
973531000 4:51836757-51836779 CAGCAATAGGAAATGGGGGAGGG - Intergenic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974970845 4:68824425-68824447 CAGCAGAAGGAAATATAGGAAGG + Intronic
974984943 4:69011978-69012000 CAGCAGAAGGAAATATAGGAAGG - Intronic
974999707 4:69207532-69207554 CAGCAGAAGGAAATATAGGAAGG - Intronic
975558345 4:75686541-75686563 CAGCAAGAGCAAAGGGTGGGTGG + Intronic
976260318 4:83139163-83139185 CAGCAGAATGACAGGGTTTAGGG + Intergenic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976453136 4:85215545-85215567 CAGCAGACAGGAAGGGTGGTAGG - Intergenic
976828269 4:89284197-89284219 CAGGTGAAGGAATGGGTGGGTGG + Intronic
977529341 4:98181894-98181916 CAGCAAAAGGAAAATGTGCATGG + Intergenic
977694434 4:99950404-99950426 CAAGCGAAGAAAAGGGTGGAGGG + Intergenic
977728070 4:100320798-100320820 AAGGAGAAGGGAAGGGAGGAAGG - Intergenic
977856441 4:101900615-101900637 CAGATGAAGGAAAGAGAGGACGG + Intronic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
979101986 4:116629552-116629574 CAGGAGGAGGAAGAGGTGGATGG - Intergenic
979872133 4:125836322-125836344 AAGAAGAAGCAAAGGGTGAAAGG + Intergenic
980109389 4:128620907-128620929 CAGCAGCTGGGAAGGGTGTATGG + Intergenic
980566823 4:134553147-134553169 CACCAGAAGGAAAGGGAGATAGG + Intergenic
980591097 4:134890649-134890671 CAGCAGAAGGAAAAGGTGCATGG + Intergenic
980969419 4:139555646-139555668 CAGCAGAAGGGAAGGGCTGGCGG + Intronic
981021534 4:140034490-140034512 GATCAGAAGGAAAGGCTGGGTGG + Intronic
981358491 4:143820636-143820658 CAGCAGCAGGAAAGGCTGTCAGG + Intergenic
982235325 4:153246818-153246840 CAGCAGATGGAATGTGTGCACGG - Intronic
982259425 4:153481341-153481363 GAGCTGAAGGAATGGGTGAAGGG + Intronic
982277810 4:153654783-153654805 CAGCAGAAGGAAAGGCAAGATGG + Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
982512034 4:156294808-156294830 CAGCAAAAGGAAAACATGGAAGG + Intergenic
982824204 4:159981826-159981848 CAGAAGAAGGAAAGAAGGGAGGG - Intergenic
983257539 4:165417138-165417160 CAGAAGAAGGAATGGGTGAGTGG + Intronic
984057583 4:174948893-174948915 CATCACAAGGAAGGGGTGGCTGG + Intronic
984123292 4:175772547-175772569 CAGCAGAATGACAGGAAGGAAGG - Intronic
984388758 4:179100070-179100092 TGGGAGAAGGAAAGGGAGGAAGG + Intergenic
984467225 4:180116100-180116122 CAGCAAGAGGAAAGTTTGGAGGG - Intergenic
984763572 4:183383052-183383074 CAGCAGAATCAGAGGATGGAGGG + Intergenic
985286056 4:188337114-188337136 CAGCAGATGGGAAAGGTGGGCGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986671771 5:10148897-10148919 CATCAGGAGGAAAGGGGGGGAGG + Intergenic
986755411 5:10831589-10831611 CTGCAGAAGCACTGGGTGGAGGG - Intergenic
987254517 5:16136811-16136833 AATCAGAAAGAAAGGATGGAAGG + Intronic
987954883 5:24726401-24726423 AAGCTGAAGGGAAGGGTGGAAGG + Intergenic
988256090 5:28822241-28822263 GAGCAGAAGGAAGAGGTGAAGGG - Intergenic
988665840 5:33326509-33326531 AAGCAAAATGAAAGGGAGGAAGG - Intergenic
989040079 5:37218468-37218490 CAGCAAAGGGAAAAGGTGCATGG - Intronic
989225182 5:39019119-39019141 CTGCAGAAGAAAAGTGTGAATGG + Intronic
989278008 5:39610974-39610996 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
990741510 5:58917064-58917086 CAGCAGAAAAAAAGGGTGAATGG + Intergenic
990886032 5:60594712-60594734 AAAAAGAAGGAAAGGATGGAGGG + Intergenic
991255828 5:64613178-64613200 AAACAGAAAGAAAGGATGGATGG + Intergenic
991293904 5:65061021-65061043 CAGCAGGAGAACAGTGTGGATGG + Intergenic
992873166 5:81026042-81026064 GAGAAGAAGGGAAGGATGGAAGG - Intronic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993328682 5:86570210-86570232 CACAAGAAGGAAAGGGTAAAGGG + Intergenic
993426131 5:87766175-87766197 AGGCAGAAGGAAAGGGAGAAGGG + Intergenic
993457236 5:88141201-88141223 CAGACGAGGGAAAGGGAGGAAGG - Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993659018 5:90607363-90607385 CAGCAGCAGCACAGGATGGAAGG - Intronic
993672395 5:90777182-90777204 GAGCAGGTGGAAGGGGTGGAGGG + Intronic
994376441 5:99020166-99020188 CAGCAGCATGGAATGGTGGAGGG + Intergenic
995897301 5:117029832-117029854 CAGCTGAAGGAAGAGGAGGAAGG - Intergenic
996849656 5:127937998-127938020 CAGCAGGGGGCAGGGGTGGAGGG - Intergenic
996946458 5:129075668-129075690 TGGCAGAAGGAAAAGGTGGGGGG + Intergenic
997178734 5:131805646-131805668 CAGCACAAGGAAAGGTCAGAGGG - Intergenic
997269652 5:132526132-132526154 CAGCAGAATGAATGGATGGAGGG - Intergenic
997591967 5:135079616-135079638 CAGCAGCATAAAACGGTGGAAGG - Intronic
997712746 5:136019679-136019701 CAGCAGAAAGGAAGGCTGCAGGG - Intergenic
998444555 5:142188511-142188533 AAGAAGAAGGAAAGGAGGGAAGG + Intergenic
998578075 5:143339681-143339703 GAGGAGAAGGATAGGGTGAAAGG - Intronic
999074774 5:148783963-148783985 CACCAGAAGGAAAGGGGTGTGGG - Intergenic
999363595 5:151006724-151006746 GGGCAAAAGGATAGGGTGGAGGG - Intergenic
999364775 5:151015217-151015239 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
999717065 5:154369839-154369861 CAGCAGAAGGGAAGCAGGGAGGG - Intronic
999930261 5:156424764-156424786 CAGCAGAGGAAAAAGGTGCATGG + Intronic
1000304085 5:159980085-159980107 CAGCAAAAGAGAAAGGTGGAAGG + Intergenic
1000414099 5:160965348-160965370 GAGCAGGAGGAAAGGGGGGCGGG - Intergenic
1000593099 5:163182415-163182437 CAGCAGACTCATAGGGTGGAGGG - Intergenic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1000803528 5:165759084-165759106 TATCAGAAGGAAAGGAAGGAAGG + Intergenic
1000900469 5:166905947-166905969 CTGTAGCAGGAAAGGGTTGAAGG - Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001272510 5:170325659-170325681 CAGCAGAAGAAAAGGAGGAATGG + Intergenic
1002647792 5:180669747-180669769 AAGCAGAAAGGAAGGGAGGAAGG + Intergenic
1002864047 6:1105584-1105606 TAGCAGAAGGGAAGGATGGCTGG + Intergenic
1003235146 6:4288776-4288798 CAGCAGAAGGGAAGTTGGGAAGG + Intergenic
1004066318 6:12248044-12248066 GAGCAGAAGACAAGAGTGGAGGG - Intergenic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1005719605 6:28588015-28588037 CAGCAGAAGGAAACAGAGAATGG - Intronic
1006410330 6:33870041-33870063 CAGCAGAGGGAAAGGGAGAGGGG + Intergenic
1006425119 6:33958892-33958914 GGGAAAAAGGAAAGGGTGGAGGG - Intergenic
1006483351 6:34316925-34316947 CTGAAGAAGGCAAGGGTGCAGGG + Intronic
1006572055 6:35013728-35013750 CAGCAGAAGGAAGGGACAGAAGG - Intronic
1006688699 6:35861191-35861213 CACCAGAAGGAAAGGGTCTGAGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007279129 6:40697412-40697434 CACCAGACGGAGAGGGTGTAGGG + Intergenic
1007306323 6:40908404-40908426 AAGAAGAAAGAAAGGCTGGAAGG + Intergenic
1007321627 6:41032306-41032328 CAGAAGCAGGAAAGGATGGAAGG - Intronic
1007695833 6:43733915-43733937 CACCCCAAGGACAGGGTGGAGGG - Intergenic
1007780989 6:44254646-44254668 CAGCAGAAGGGGATGGTGGGAGG + Exonic
1007817607 6:44535552-44535574 TAGCTGAAGGAAATGGGGGAGGG + Intergenic
1007907767 6:45480162-45480184 CAGCATTAAGAAAGAGTGGATGG + Intronic
1008192326 6:48475295-48475317 CAGCAGAAGGATAGGGTACAGGG + Intergenic
1008209689 6:48705164-48705186 CAGCAGAAGGGAGGGAGGGAGGG + Intergenic
1008652457 6:53577081-53577103 GAGGGGAAGGAATGGGTGGATGG - Intronic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1009950243 6:70387065-70387087 CAACTGAAGAAAAGGGAGGAAGG - Intergenic
1010094182 6:72020462-72020484 CAGCAGAAGGCAAGGGCTGCTGG - Intronic
1010621514 6:78082465-78082487 CAGAGGCAGGAAAGGGTAGAGGG + Intergenic
1012223699 6:96681315-96681337 CAGCAGGAGGAAAGGGCAGTAGG + Intergenic
1012612287 6:101230899-101230921 CACAAGAAGGAAAGGGTAAAGGG + Intergenic
1012734208 6:102918108-102918130 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1012788530 6:103661567-103661589 CAGCAGAAAGAAAAGGAGGAAGG - Intergenic
1012924148 6:105250796-105250818 CAGCAGAGGGAAAAAGTGCATGG + Intergenic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013564423 6:111342859-111342881 CAGCAAAATGAGAGGCTGGAAGG + Intronic
1013564647 6:111345749-111345771 CAGCAGCAGGAAAGGGACAAGGG - Intronic
1015652177 6:135475764-135475786 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1016245912 6:141980599-141980621 GAAGAGAAGGAAAGGGAGGATGG + Intergenic
1016437311 6:144050013-144050035 CAGAAGGGGGAAAGGGTGAATGG + Intronic
1017620703 6:156293717-156293739 GAGCAGGAGGAAAGAGTGAAGGG + Intergenic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1019057277 6:169232574-169232596 CAGCAGGAGGAAGGAGAGGAAGG - Intronic
1019320318 7:412157-412179 CAGCAGCAGGAACAGGTGGGAGG + Intergenic
1019531680 7:1506548-1506570 GAGAAGAAGGAAGGGGAGGAGGG - Intergenic
1019675528 7:2309819-2309841 CAGCTGCAGGTAAGGGTTGATGG + Intronic
1019720377 7:2566921-2566943 CATCAGAAGGAATGGGTGGGTGG - Intronic
1019860717 7:3656189-3656211 AAGGAGAAGGGAAGGATGGAGGG - Intronic
1020042105 7:5012125-5012147 CAGCAGAAGCAATGGAAGGATGG - Intronic
1020334683 7:7053682-7053704 CAGCAGAAGAAAAGAAAGGAGGG - Intergenic
1021223275 7:17999171-17999193 TATCAGAAGCAAGGGGTGGATGG - Intergenic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021521066 7:21539514-21539536 CAAGAGAAGGAAAAGGTGAATGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1022100576 7:27166776-27166798 TAGCAGCTGGAAAGGGAGGAAGG - Intronic
1022122235 7:27320315-27320337 CAGCATCAGGAAAGTGTGAAGGG + Intergenic
1022238674 7:28488146-28488168 GATCAGAGGGAAAGGGAGGAAGG - Intronic
1022897052 7:34761098-34761120 AAGCAGGAGGTAAGGGAGGAAGG - Intronic
1022981780 7:35611148-35611170 CAGCAGGAGGGTAGGGTGGCTGG + Intergenic
1023105193 7:36756888-36756910 CAGCAGGAGAAAAGTCTGGAGGG + Intergenic
1023791461 7:43757016-43757038 CAGCAGCAGGGAGGGGTGGATGG + Intergenic
1023981157 7:45070968-45070990 CAGCAGCAAGAAAGGGAAGAAGG - Intronic
1024232893 7:47376212-47376234 CAAGAGATGGAAAGGGTGGTGGG + Intronic
1024233085 7:47377710-47377732 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024515940 7:50256138-50256160 GGGCAGAAGGACAAGGTGGAAGG - Intergenic
1024559070 7:50628409-50628431 CAGCAGAGGGAAGGGCTGGGAGG + Intronic
1024581738 7:50806233-50806255 CAGGAGAAGGGAAGGGGGCAAGG - Intergenic
1025078540 7:55963754-55963776 CAGGAGAAAGAAAGGAGGGAAGG - Intronic
1025206185 7:56994518-56994540 CACCAGAAAGAAAAAGTGGATGG + Intergenic
1025665754 7:63582421-63582443 CACCAGAAAGAAAAAGTGGATGG - Intergenic
1026545174 7:71316141-71316163 GAGCAGGAGCAAAGGGAGGAAGG + Intronic
1026564944 7:71481935-71481957 CATCAGAAGGAAAGGAAAGAAGG + Intronic
1026653921 7:72239921-72239943 CAACACAAGCCAAGGGTGGAAGG + Intronic
1028163343 7:87510326-87510348 CAGGGGTAGGAAAGGGTGAATGG + Intronic
1028311182 7:89338522-89338544 AAAGAGAAAGAAAGGGTGGAGGG + Intergenic
1028518945 7:91707724-91707746 CAGCAGTAGGAATGGGTGTGTGG - Intronic
1028570492 7:92281048-92281070 CAGCAAAGGGAAAGGGTTCATGG + Intronic
1028829815 7:95314768-95314790 CAGCAAATGGAAAGGGAGAAAGG + Intronic
1028832463 7:95342702-95342724 CAGGAGAATGAAAGGGGAGAAGG - Intergenic
1029574015 7:101391087-101391109 CAGCGGAAGGAAAGGGGGATGGG + Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1031640171 7:124153364-124153386 GACCATAAGGAAAGGCTGGAGGG + Intergenic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1032284529 7:130530758-130530780 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032285347 7:130535321-130535343 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032286131 7:130539721-130539743 CAGAAGACAGACAGGGTGGAGGG + Intronic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1032739281 7:134722767-134722789 TAGCAGAAAGGAAAGGTGGAGGG - Intergenic
1033375363 7:140756359-140756381 CTGTAGAATGAAAGGCTGGAAGG + Intronic
1034718098 7:153262323-153262345 ACTCAGAAGGAAAGGCTGGAAGG + Intergenic
1034811645 7:154137625-154137647 CAGCAGGAGGAGATGGTGGGGGG + Intronic
1034899258 7:154897416-154897438 CAGCAGGAAAAAAGGGCGGAAGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035355263 7:158272812-158272834 CGGCAGAAGGAGAGGTGGGAAGG + Intronic
1035432389 7:158831729-158831751 TACAAGAAGGAAAGGATGGAGGG - Intergenic
1035491364 7:159281690-159281712 CAGCAGAAGGGAGGGGTTGATGG - Intergenic
1035492048 7:159288451-159288473 CAGCAGAAAGGAGGGGTTGATGG - Intergenic
1035599726 8:890564-890586 CCGCAGAGGGAAGGGGAGGAGGG - Intergenic
1036282862 8:7416619-7416641 AAGCAGGAGAAAAGGATGGAGGG + Intronic
1036338607 8:7894899-7894921 AAGCAGGAGAAAAGGATGGAGGG - Intronic
1036474155 8:9077888-9077910 TGGCAGAAAGAAAGGTTGGATGG - Intronic
1037053796 8:14410217-14410239 AGGCAGAAGGAAAGGGAGGAGGG - Intronic
1037274194 8:17159844-17159866 TAAGAGAAGGAAAGGATGGAGGG - Intronic
1037346285 8:17904868-17904890 CTGCAGAAGGTAATGATGGATGG + Intronic
1037542461 8:19885586-19885608 GAAAAGAAGGAAAGGGAGGAGGG - Intergenic
1037598418 8:20373674-20373696 GAGGAGGAGGAAATGGTGGAGGG + Intergenic
1037914588 8:22765140-22765162 CAGAAGAAAGAAAGGAAGGAAGG - Intronic
1039169712 8:34729360-34729382 CGACAGAAGGAAAGGAAGGAAGG + Intergenic
1039397670 8:37240940-37240962 AAGCAGGAGGGAAGGGAGGAGGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039706492 8:40012747-40012769 GAGGAGAAGGAAAGGGGGAAGGG + Intronic
1039798442 8:40934650-40934672 GAGCAGAAGGAAATGATTGAAGG + Intergenic
1039964549 8:42274464-42274486 CAGAGGCAGGAAAGGGTGGTGGG - Intronic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042214666 8:66418218-66418240 CAGGAGAGGAAAAGGGTGGAAGG + Intergenic
1042710661 8:71713376-71713398 CACTAGGAGGAAATGGTGGATGG - Intergenic
1043464835 8:80494485-80494507 AAACAGATGTAAAGGGTGGAGGG - Intronic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044031479 8:87242936-87242958 CTGAAAAAGGACAGGGTGGAGGG + Intronic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1044604440 8:94036601-94036623 AAGAAGAAGGAAAGGATGGTGGG - Intergenic
1044911478 8:97064258-97064280 CAGGAGAGGGAAAGGGTTTAGGG + Intronic
1046088029 8:109463270-109463292 CAGCAGAAGGAAGGAAGGGAGGG + Intronic
1046418334 8:113944428-113944450 CAGTAGAAGGAAAGGTTTAAAGG + Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046673525 8:117083656-117083678 CAGCAGAAGGAAAGTGTCTTGGG - Intronic
1047301137 8:123614254-123614276 CAGAAGAAGGAAAGCCTGGAAGG + Intergenic
1047526365 8:125637756-125637778 CAGCTGAAGGAGGGGGTGGTGGG + Intergenic
1048191343 8:132292582-132292604 CAGAGGAATGAATGGGTGGATGG + Intronic
1049446573 8:142634173-142634195 CAGCAGAAGGTATGGGAGGGGGG + Intergenic
1049455241 8:142683274-142683296 GCGCAGAAGGCAAGTGTGGATGG - Intergenic
1049708601 8:144053851-144053873 CAGCTGCAGGGAAGGGGGGATGG - Intronic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050113755 9:2242276-2242298 ATGCAAAAAGAAAGGGTGGAAGG + Intergenic
1050183157 9:2942268-2942290 CAGCAGATGGTATGGTTGGAAGG + Intergenic
1050347931 9:4711213-4711235 CAGCAGAAAGGAAGGTGGGATGG + Exonic
1050761580 9:9078678-9078700 CAGCTGCAGGAAAGTATGGATGG + Intronic
1051534334 9:18140364-18140386 CAGCAAAGGGAAAAGGTGTATGG + Intergenic
1051543461 9:18247761-18247783 CAGAAGAAGGAAAGGAGGGAGGG + Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1052904008 9:33817815-33817837 CTGCAGGAGGAACCGGTGGAGGG + Exonic
1053290868 9:36878983-36879005 ATGCAGAAGGAAAGAATGGAGGG + Intronic
1054753292 9:68930446-68930468 AAGCAGAAGGAAGGGGTCAAGGG - Intronic
1054870037 9:70040723-70040745 AGGAAGCAGGAAAGGGTGGAGGG - Intergenic
1055197583 9:73615089-73615111 GAGCAAAGTGAAAGGGTGGAAGG + Intergenic
1055511033 9:76995785-76995807 GAGCAGAAGGAAGGGGGTGAGGG - Intergenic
1055572498 9:77631837-77631859 CTGCAGCAGGAAAGCGTGGCTGG + Intronic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057542939 9:95992733-95992755 CAGCTGGAGGCCAGGGTGGAGGG + Intronic
1057874376 9:98742828-98742850 CAGAAGAGGGAATGGGTGGGGGG + Intronic
1058116635 9:101092047-101092069 CAGCTGAAATAAAGGGTGCAAGG - Intronic
1058577804 9:106422224-106422246 TAGCAGAAGGGAAGGGAGAAAGG - Intergenic
1059526400 9:114994738-114994760 CAGGAGAAGGAAAGCATGCAAGG - Intergenic
1059635933 9:116170709-116170731 TAGCAGAAAAGAAGGGTGGATGG - Intronic
1060607894 9:124933928-124933950 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1060830124 9:126708452-126708474 CAGCACAAGGCAAGGATGTAAGG - Intergenic
1061237512 9:129351424-129351446 CAGGAGGAGGAAAGGGGGGGAGG + Intergenic
1061237654 9:129351924-129351946 CTGCAGAAGGAAGGCGGGGAGGG - Intergenic
1061307363 9:129739815-129739837 CAGGAAAAGGAAGGGGTAGATGG + Exonic
1061591981 9:131603619-131603641 CACCAGAAGATAAGGGAGGAAGG + Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1203549748 Un_KI270743v1:157358-157380 GAGGTGAAGGAAATGGTGGAGGG - Intergenic
1187392221 X:18893656-18893678 CTGCAGTAGGAAAGGGCAGAGGG + Intronic
1187937776 X:24352708-24352730 CAGCAAAGGGGAAGGGTGCATGG - Intergenic
1187965397 X:24606471-24606493 CAGAAGGAGGAAATGGTGGAAGG - Intronic
1188818187 X:34741150-34741172 CAGCAGAAGAAAAGGACAGATGG - Intergenic
1189701355 X:43718121-43718143 TGGCAGAAGGTATGGGTGGATGG + Intronic
1189701367 X:43718177-43718199 TGGCAGAAGGTATGGGTGGATGG + Intronic
1189753074 X:44242753-44242775 CAGTAGGAGGAGATGGTGGATGG - Intronic
1189853096 X:45196271-45196293 CACCTGAATGAATGGGTGGATGG + Intronic
1190286888 X:48967285-48967307 CAGCAGATGGTAGGGGTTGAGGG - Intronic
1190712791 X:53081871-53081893 GAGCTGAAGGAAATGGGGGAAGG + Intergenic
1192009305 X:67250739-67250761 CACCAGAGGGAACGGGTGGCTGG + Intergenic
1192190060 X:68985571-68985593 GAGGAGAAGGACAGGGGGGAAGG + Intergenic
1192252856 X:69427766-69427788 CAAAAGAAGGAAAGAGTGGTGGG + Intergenic
1192447790 X:71223569-71223591 CAGTAGCAGGAAAGGAAGGATGG - Intronic
1192656447 X:72999816-72999838 TAGAGGAAGGAAAGGGAGGAAGG - Intergenic
1192665673 X:73083185-73083207 TAGAGGAAGGAAAGGGAGGAAGG + Intergenic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1193005394 X:76612786-76612808 CAGAAGATGGAAAGGGTAAAGGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193392792 X:80948952-80948974 CAGCAGAATGAATGAGTGCATGG - Intergenic
1196318588 X:114260742-114260764 CAGAAGATGGAGAGAGTGGATGG - Intergenic
1196586612 X:117436473-117436495 TAGGAGAAGCAAAGAGTGGAGGG + Intergenic
1197190586 X:123643097-123643119 CACCAGATGGAAAGGGGGAAAGG + Intronic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197551111 X:127893907-127893929 CAGCAGAAGCAAGGGGTGGGGGG - Intergenic
1197741095 X:129894647-129894669 CAGTATAAAGAATGGGTGGAGGG + Intergenic
1198486991 X:137097294-137097316 TGGCACAAAGAAAGGGTGGAGGG + Intergenic
1198806706 X:140501569-140501591 CAGGAGGAGGACTGGGTGGAGGG + Intergenic
1199312769 X:146340924-146340946 AAGAAGAAGGAAAGGAAGGAAGG - Intergenic
1199745891 X:150771768-150771790 AAGCAAAAGGAAAGTGAGGAAGG + Intronic
1200085772 X:153604063-153604085 CAGCCACAGGAAAGGGTGGGGGG - Intergenic
1200758586 Y:7015335-7015357 CAGCAGTAAGACAGGATGGAGGG + Intronic
1200932911 Y:8713210-8713232 CAGAAGAAGGAAAGGGTAAAGGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic