ID: 902706750

View in Genome Browser
Species Human (GRCh38)
Location 1:18210689-18210711
Sequence TGCTAAACACCCTGCAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902706750 Original CRISPR TGCTAAACACCCTGCAGTGC GGG (reversed) Intronic
900542141 1:3208315-3208337 CACTAAACACCCTACAGTGCAGG - Intronic
902706750 1:18210689-18210711 TGCTAAACACCCTGCAGTGCGGG - Intronic
904433014 1:30477230-30477252 TCCAAACCACCCTGCAGTGTAGG + Intergenic
904439432 1:30520705-30520727 TACTAAGCACCCTGCTGTGCTGG - Intergenic
908984993 1:70006971-70006993 TGCTAAACACACAGAAATGCTGG - Intronic
910487582 1:87732587-87732609 TGCTAAACACCCCTCAATGCAGG + Intergenic
916336262 1:163674050-163674072 TACTAAAGACTCTGCAATGCAGG + Intergenic
918702476 1:187622162-187622184 TGGCAAACATCCTGCATTGCTGG - Intergenic
920294594 1:204948161-204948183 TGCCTAACTCCCTGCAGAGCTGG + Intronic
1063859906 10:10295760-10295782 TGCTGGACAGCCTGAAGTGCAGG - Intergenic
1067550053 10:47227734-47227756 TGCTCCCCTCCCTGCAGTGCTGG - Intergenic
1069186282 10:65427694-65427716 TGCTGAAAACCATGCAATGCAGG + Intergenic
1069266542 10:66465505-66465527 TGAAAAACACGCTTCAGTGCAGG - Intronic
1075777660 10:124998764-124998786 TGCTCAGCACCCTGCTCTGCTGG + Intronic
1080884408 11:36353110-36353132 TGCTAAACATCCTACAATGTGGG - Intronic
1081553773 11:44138759-44138781 TGGTACACACCCGGCAGAGCAGG - Intronic
1081643757 11:44776120-44776142 GGCTTTACAGCCTGCAGTGCAGG + Intronic
1095948124 12:47765466-47765488 TGCCTAACACACTGCAGGGCTGG + Intronic
1096196904 12:49654591-49654613 AGCCAAAGACCCTGCAGTGAGGG + Intronic
1097627201 12:62014823-62014845 TGGAAACCACCCTGCAATGCTGG + Intronic
1103920892 12:124398666-124398688 TGCTAAGCATCCTGCCGTGATGG - Intronic
1104378350 12:128285164-128285186 TCATAGTCACCCTGCAGTGCTGG - Intronic
1110938231 13:81318765-81318787 TGAAATGCACCCTGCAGTGCTGG - Intergenic
1113655351 13:112064730-112064752 TGCAAAGCACACTGGAGTGCAGG + Intergenic
1113793402 13:113042596-113042618 TGCCTCACACCCGGCAGTGCAGG - Intronic
1114748516 14:25177366-25177388 TGCCAAACAGCCTGCAGTACTGG - Intergenic
1114769114 14:25408581-25408603 TGCTTAAAACTCTGCAGTGGCGG - Intergenic
1116891907 14:50276913-50276935 TGCTAAACATCCTTCAGTGTGGG - Intronic
1119677851 14:76569298-76569320 TGCTAAACATCCTGCCATGTAGG + Intergenic
1121144183 14:91569140-91569162 TGCTAATCGCCCTGAAGTTCTGG - Intergenic
1123538432 15:21262037-21262059 TGGTACACTCCCTGCAGTGTGGG - Intergenic
1125398796 15:39278275-39278297 TCCTATACACCCTGCAGAACTGG + Intergenic
1126159308 15:45595075-45595097 TGCTGAACACACTGATGTGCTGG - Intronic
1128796727 15:70471785-70471807 AGCTCAGCACCCAGCAGTGCAGG + Intergenic
1129288660 15:74546253-74546275 TGCCAACCACACAGCAGTGCGGG - Intronic
1130104365 15:80918471-80918493 TGCTAAACAACCTGCAATCACGG + Intronic
1133091899 16:3411218-3411240 TACTGAACCGCCTGCAGTGCCGG + Intronic
1134516791 16:14894113-14894135 TGCTAAAGCCCCTGAAATGCTGG - Intronic
1134704462 16:16292767-16292789 TGCTAAAGCCCCTGAAATGCTGG - Intronic
1134963080 16:18419347-18419369 TGCTAAAGCCCCTGAAATGCTGG + Intronic
1134967375 16:18501946-18501968 TGCTAAAGCCCCTGAAATGCTGG + Intronic
1135924119 16:26677206-26677228 TTCTAATCACCCTGCAGGGGAGG + Intergenic
1137382431 16:48011760-48011782 CTCTAATCACCCTGCAGTGGAGG + Intergenic
1137404028 16:48176177-48176199 AGCTCTTCACCCTGCAGTGCAGG + Intronic
1139524236 16:67503835-67503857 TGCTGAAGACTCTGCAGTGCTGG + Intergenic
1143151804 17:4811591-4811613 TTCTAAGCACCTAGCAGTGCTGG + Intronic
1144148703 17:12422781-12422803 ATCCACACACCCTGCAGTGCAGG + Intergenic
1144948977 17:18983933-18983955 TGTTAAACATCCTACACTGCCGG - Intronic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1148792619 17:50182085-50182107 TGCTCAACACCCTACTGTCCGGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152011827 17:77723720-77723742 TGCTGAACACCCTTCAGTGCTGG + Intergenic
1159552178 18:69906782-69906804 TTCCAAACACCCTGCAATGCAGG + Intronic
1160683425 19:423024-423046 TGGTTCAGACCCTGCAGTGCTGG + Intronic
1160986677 19:1842338-1842360 TGCTCAGCACCCTTCAGTGCTGG - Intronic
1163540192 19:17904253-17904275 TGCTAAACATCCTACAGGCCGGG - Intergenic
1164400551 19:27899384-27899406 TGCTAAACATCCTACAATCCAGG - Intergenic
1166266897 19:41690170-41690192 TGCCCAACTCCATGCAGTGCAGG + Intronic
1166886214 19:45962503-45962525 TGCTTAACACCCTCCACTCCTGG + Intronic
930300035 2:49603845-49603867 GGCTAAAGACCCTGCTGTCCAGG - Intergenic
930675674 2:54197849-54197871 TGCTTAAAACCCTCCAGTGTAGG - Intronic
931461944 2:62457195-62457217 TGCCAAGCCCCCTGCCGTGCGGG + Intergenic
931561549 2:63567081-63567103 TGGTGAACACATTGCAGTGCTGG - Intronic
932975958 2:76599873-76599895 TGCTAGACACAGTGCAGTGCAGG + Intergenic
934817545 2:97341977-97341999 TGGTAAACACATTGAAGTGCTGG + Intergenic
934820151 2:97366507-97366529 TGGTAAACACATTGAAGTGCTGG - Intergenic
935490747 2:103717044-103717066 TGCTAAACACCCTGGTTTGGAGG - Intergenic
937617810 2:123946580-123946602 TGCTTAACCTCCTGAAGTGCTGG - Intergenic
941885149 2:170520214-170520236 TGCTAAACCTCCTGCAATGTAGG + Intronic
944915799 2:204359052-204359074 GGCTAAACACTCTGCATTGAAGG - Intergenic
946039089 2:216768726-216768748 TGCTAAACTCATTGCAGTGGTGG + Intergenic
947024390 2:225720540-225720562 TGCCAATCACCCTGCAGATCTGG - Intergenic
947047962 2:226009396-226009418 TGCTTAAAATCCTGCAGTGGGGG - Intergenic
948418704 2:237838592-237838614 TACTAAACACCTTGCAGTTTGGG + Intronic
949021428 2:241743217-241743239 TGCTCAACACCCAACAGTGCAGG - Intronic
1169332999 20:4731038-4731060 TGCAAAACACCCTTCCCTGCTGG - Intergenic
1169349798 20:4858954-4858976 TGCCAAAGGCCCTGCAGTGTGGG - Intronic
1175281226 20:57805228-57805250 TGCCAGGAACCCTGCAGTGCTGG - Intergenic
1175998987 20:62823810-62823832 TGCAAGGCCCCCTGCAGTGCCGG + Intronic
1179799175 21:43802915-43802937 TGCTCAACCCCCTCCACTGCAGG - Intronic
1180904043 22:19396020-19396042 TGATATGCACCCTGCAGTTCAGG - Intronic
1181643397 22:24216764-24216786 TGCTCAACATCCTACAGTGTGGG + Intergenic
1182327648 22:29525828-29525850 TGCTCAATACCCTGCACTGATGG + Exonic
1182620724 22:31617087-31617109 TGCGAAACGCCCTGCAGCCCTGG + Intronic
1185159495 22:49214696-49214718 TTCTAAACACCCCACAGTGCAGG + Intergenic
949674872 3:6442122-6442144 AGACAAAGACCCTGCAGTGCAGG - Intergenic
952495679 3:33913847-33913869 TGCTAAAAACACTGCACTGAAGG - Intergenic
954385536 3:50241980-50242002 TGCCCCACCCCCTGCAGTGCTGG - Intronic
956815382 3:72903640-72903662 TGCCAAACACCATGTAGGGCAGG - Intronic
956885532 3:73555436-73555458 TTCTAAACATCCTGGACTGCAGG - Intronic
961997462 3:131260969-131260991 TGCTAAACACCCTGCCATGTGGG - Intronic
964239962 3:154580802-154580824 TGCTGAACACACTGAAGTGCTGG + Intergenic
965781281 3:172288834-172288856 TGCTAACCACCCTGCATGTCTGG + Intronic
969840551 4:9878492-9878514 TGGTAAACGCACTGAAGTGCTGG + Intronic
972463448 4:39328786-39328808 TGGAAAACACACTGCAGAGCGGG + Intronic
972836967 4:42883147-42883169 GGATAAATACCCAGCAGTGCTGG + Intergenic
977963225 4:103109803-103109825 AGCTTAAAACCCTCCAGTGCAGG + Intronic
977996163 4:103499287-103499309 TGCTAAGCACTCTGCAGTGAAGG - Intergenic
982017493 4:151169341-151169363 TGCCAAACAGCCTGCGGTGGTGG - Intronic
986032544 5:3907899-3907921 TACTAAACACCCTACTTTGCAGG + Intergenic
988558040 5:32255155-32255177 TACTAAATACCCTGCAGGCCTGG + Intronic
995596607 5:113754138-113754160 TGATAAACACCCTACAATACAGG - Intergenic
997595040 5:135101653-135101675 TGTTAAAAACCTGGCAGTGCAGG + Intronic
999293798 5:150445271-150445293 TGCTGAACATCCTACAATGCAGG + Intronic
1000273519 5:159710482-159710504 TGAGAAAAGCCCTGCAGTGCTGG + Intergenic
1002973876 6:2054112-2054134 TTCCTAACACCCTGCAGTGGAGG - Intronic
1003147481 6:3520873-3520895 TGCTGAAGACCCTGCTGTGCTGG + Intergenic
1004143300 6:13041773-13041795 TGCTCAAGACCAGGCAGTGCAGG - Intronic
1012802668 6:103851933-103851955 AGCTGAAGACCCTGCAATGCTGG - Intergenic
1013901928 6:115167253-115167275 TGTAGAACAGCCTGCAGTGCTGG - Intergenic
1017715983 6:157213457-157213479 TGTCCAACACCCTGCAGTGGTGG + Intergenic
1018421926 6:163647549-163647571 CGCTAAACCTCCTGCAATGCAGG + Intergenic
1019523346 7:1470180-1470202 TGCTCAACTCCCTGCACTGTGGG + Intergenic
1020897073 7:13953526-13953548 TGAGAAACACCCGGAAGTGCTGG - Intronic
1025908464 7:65808450-65808472 TGCTGAGCACCGTGCAGGGCAGG - Intergenic
1027994126 7:85402266-85402288 TGTATAACACCTTGCAGTGCTGG - Intergenic
1032698932 7:134361823-134361845 TGCTAAACATCTTACAGTGCAGG - Intergenic
1032900885 7:136305974-136305996 TGCTAAGCAACATGTAGTGCAGG + Intergenic
1034445371 7:151111311-151111333 TGCTCCACACCCTGCGGAGCTGG + Intronic
1037226976 8:16604057-16604079 TGCTAAAGACCCTGCAGTTTTGG + Intergenic
1038040051 8:23716812-23716834 TGCAAGACACCCTCCAGGGCTGG - Intergenic
1038944712 8:32345806-32345828 TACTAAAAACCCTGCAGAGACGG + Intronic
1041644473 8:60237607-60237629 TGGTAAACACACTGCACAGCAGG + Intronic
1042031500 8:64480832-64480854 ATTTAAACACACTGCAGTGCTGG + Intergenic
1042063442 8:64846714-64846736 TGATAAACACCCTGAAGCGTTGG - Intergenic
1043354451 8:79395873-79395895 TGCTCAACACTCTACAATGCAGG - Intergenic
1044348427 8:91134242-91134264 AGCTGAAGACCCTGGAGTGCTGG + Intronic
1045112082 8:98945551-98945573 TGCTAAACAAACTGCAGTCCTGG + Intronic
1048526767 8:135210017-135210039 TGCTGAACACCATGCTGGGCAGG - Intergenic
1048919668 8:139216729-139216751 AATTAAACACCCTGCAGTGAGGG - Intergenic
1049692853 8:143970142-143970164 GTGCAAACACCCTGCAGTGCTGG - Intronic
1050589098 9:7144404-7144426 TGCTCAAAACCTTGCACTGCTGG + Intergenic
1051528332 9:18072377-18072399 TGCTACTCACCCTGCAGTATTGG + Intergenic
1051703240 9:19847680-19847702 TGGTAAACTACCTCCAGTGCGGG - Intergenic
1056613565 9:88141659-88141681 TGGTCTACACCCTGCAGTGGAGG + Intergenic
1058807528 9:108606823-108606845 TGCTAAACATCTTACAGCGCAGG - Intergenic
1187766104 X:22643943-22643965 TGCTATACACCATGAAGTGGCGG + Intergenic
1188784801 X:34332554-34332576 TGCTAAACATCCTACACTGCAGG + Intergenic
1188913778 X:35884237-35884259 TGCTATAAACACTTCAGTGCAGG + Intergenic
1198196086 X:134363839-134363861 TGCTAAAAACCCTGTATTCCAGG - Intergenic