ID: 902706753

View in Genome Browser
Species Human (GRCh38)
Location 1:18210718-18210740
Sequence GGCATCTGGTGTGCAGGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902706753 Original CRISPR GGCATCTGGTGTGCAGGAAC CGG (reversed) Intronic
900118378 1:1038258-1038280 CCCATCTGGTGTGCAGGGCCAGG - Intronic
900246948 1:1640751-1640773 GGCCTCTGCTCTGCAGGGACAGG + Intronic
900258170 1:1707883-1707905 GGCCTCTGTTCTGCAGGGACAGG + Intronic
900824393 1:4914348-4914370 GGCACCTGGTGGGCAGGACCTGG + Intergenic
901030013 1:6301588-6301610 GGCATCTGGTGCTCAGGAAATGG + Intronic
901125088 1:6923606-6923628 GGCTTCTGGTATGCAGGAAGAGG + Intronic
902706753 1:18210718-18210740 GGCATCTGGTGTGCAGGAACCGG - Intronic
902783953 1:18721172-18721194 GGCATCTGGGGTTCAGGCCCGGG - Intronic
902882621 1:19382750-19382772 GGCAGCTGTTCTGCAGGAGCTGG - Intronic
904592020 1:31620213-31620235 GCCCTCTGGGGTGCAGGAAGTGG - Intronic
905514363 1:38551077-38551099 GGCATTGGGTGTACAGGAAATGG + Intergenic
907502054 1:54887791-54887813 GGCCTCTGGAGTTCACGAACAGG - Intergenic
911167536 1:94737546-94737568 GGCATCTTGTCTGCAGCAAGAGG - Intergenic
917511085 1:175669865-175669887 AGCATCTCCAGTGCAGGAACAGG + Intronic
919978994 1:202630732-202630754 GGCCTCTGGTGTCCTGGACCAGG - Intronic
920381405 1:205536572-205536594 GGCATCTGGTTTCCAGGGACTGG + Intergenic
921477827 1:215631812-215631834 GGTAAAGGGTGTGCAGGAACAGG + Intronic
1066094614 10:32060182-32060204 AGAATCTGTTGTGCAGGAAGAGG - Intergenic
1066610792 10:37246828-37246850 GGCCTCTAGTGGGCAGGATCTGG - Intronic
1067278313 10:44853320-44853342 GGCAACTGCTGTGCAGGAGAGGG - Intergenic
1067560829 10:47303283-47303305 GGCATTTGTTGTTCAGGAAGAGG - Intronic
1067924673 10:50496161-50496183 GGCACATGCTGTGCAGGAAAAGG + Intronic
1068688189 10:59890286-59890308 GGAAGCTGGTGTGGAAGAACAGG + Intronic
1069796586 10:71056747-71056769 GGCATGTGGTGTTCAGGCTCTGG - Intergenic
1072294341 10:93994466-93994488 GGCGTCTGGAGTGAAGGCACTGG - Intronic
1072641544 10:97214823-97214845 ACCATCTGGTGTGGAGGAAAAGG - Intronic
1074507015 10:114080010-114080032 TCCATCTGGAGTGCAGAAACAGG - Intergenic
1077116942 11:889466-889488 GGTAGCTGGAGTGCAGGAGCAGG - Intronic
1078912398 11:15745195-15745217 GCCATCTTGTGAGCAGGAAGAGG - Intergenic
1081804162 11:45881204-45881226 GGCAGCTGGCTTGCAGGAACAGG - Exonic
1082051707 11:47775641-47775663 GTCACCTGGAGTGCAGGCACTGG + Intergenic
1082766477 11:57172309-57172331 AGCATCTTGTGGGCAGGTACAGG - Intergenic
1083458171 11:62792697-62792719 GGCACCTGGAGTGGAAGAACAGG + Exonic
1083777091 11:64899378-64899400 GCCAGCGGGTGTGCAGGAAGAGG - Intronic
1084387074 11:68850382-68850404 GTCATCTTATGTGCAGGAAAAGG - Intergenic
1088923418 11:114278519-114278541 GGCACCTGGTGTGATAGAACAGG + Intronic
1089002781 11:115066003-115066025 AGCATCTGGTCTGCATGAACTGG + Intergenic
1091096085 11:132823428-132823450 GGAATCTAGGGTGCAGGAAAAGG - Intronic
1091229188 11:133976913-133976935 GGACTCAGGTGTGCAGGGACTGG - Intergenic
1091999774 12:5022621-5022643 GCCATCTGCTGGGCAGGAAGGGG - Intergenic
1093688914 12:22087343-22087365 GGCATCTGGTGGGAAGTGACTGG + Intronic
1098232305 12:68384228-68384250 AGCATGTTGTGTACAGGAACTGG + Intergenic
1098291301 12:68959029-68959051 GACAGCTGGGGTGCAGGAACTGG - Intronic
1101442250 12:104712593-104712615 AGCATTTGGTGTGAAGGAGCTGG + Intronic
1102012237 12:109625840-109625862 GGCATCTGGTGGGCGGGGGCTGG - Intergenic
1103614845 12:122145543-122145565 GGCAGCTGGGGTGCAGGTAAGGG + Exonic
1103899780 12:124297304-124297326 GGCATCTAGTGAGCAGGAAGGGG - Intronic
1105840711 13:24251733-24251755 GGCACCTGGTGAGCAGGCATGGG - Exonic
1106022249 13:25926484-25926506 GGACTCTGGGGAGCAGGAACTGG + Intronic
1106411639 13:29515080-29515102 GGAGTCCCGTGTGCAGGAACAGG - Intronic
1106476806 13:30105851-30105873 GGCCTCTGGAGGGAAGGAACTGG + Intergenic
1112435413 13:99388489-99388511 GGCATCTGGAGTGGAGGAAGAGG + Intergenic
1117283388 14:54262626-54262648 GACATCTTGTGTGCATGGACTGG - Intergenic
1124372658 15:29112174-29112196 GGGAGCTGGTGGGCAGGGACTGG + Intronic
1124434197 15:29634132-29634154 GGCATCTGGTGCACATGAAGGGG - Intergenic
1124494591 15:30178618-30178640 GGCCTCTGGTGTCCTGGACCAGG - Intergenic
1124748979 15:32360027-32360049 GGCCTCTGGTGTCCTGGACCAGG + Intergenic
1125718655 15:41834668-41834690 GGCATCTCTTGGGCAGGGACTGG + Intronic
1126681317 15:51204949-51204971 GGCATCCAGTGTGCACCAACTGG - Intergenic
1128807579 15:70542920-70542942 AACATCTTGTGTTCAGGAACTGG + Intergenic
1128949386 15:71860434-71860456 GGCAGCTGGTGAACAGGAAGAGG + Intronic
1129232813 15:74206123-74206145 GGTTACTGGTGTGCAGGGACGGG - Intronic
1129693523 15:77727643-77727665 GGAATCTGGTGTACAGTAAGGGG + Intronic
1129878307 15:78991509-78991531 AGAATTTGGTGGGCAGGAACGGG + Intronic
1129960407 15:79679647-79679669 GGCCTCTGGTTTGCAGGCTCTGG + Intergenic
1131750572 15:95503204-95503226 GGCATCTGGGGTGCCAGACCTGG - Intergenic
1133229115 16:4358160-4358182 GGCATCTGTTGGGGAGGGACAGG + Intronic
1134237747 16:12480836-12480858 GGTCTCTGCTGTGCAGGAGCTGG + Intronic
1136345266 16:29671458-29671480 GGCACCTGGAGAGCAGGAATGGG - Intronic
1137236767 16:46623960-46623982 GGCTTCTGGGGTGGAGGGACGGG + Intergenic
1139008073 16:62598183-62598205 GTCATATGGTGATCAGGAACAGG + Intergenic
1139478634 16:67216001-67216023 GGCAGCTGGTGGACATGAACAGG - Intronic
1139588062 16:67916956-67916978 GGCCTGTGGTGTGCAGGGAGTGG - Intronic
1139850815 16:69950877-69950899 TCCTTCTGGTGAGCAGGAACTGG - Intronic
1140372725 16:74421759-74421781 TCCTTCTGGTGAGCAGGAACTGG + Intronic
1141481904 16:84312320-84312342 GGAATCTGGTGGGCAGTGACTGG - Intronic
1141614336 16:85202148-85202170 GGCCTGTGATGTGGAGGAACTGG + Intergenic
1141793432 16:86252201-86252223 AGCACCTGGAGAGCAGGAACTGG + Intergenic
1142127518 16:88417537-88417559 GGCATCTGGCTTGCGGGGACTGG - Intergenic
1142165203 16:88583013-88583035 GGCATCTTGTCTGCAGGATGTGG - Intronic
1142563662 17:825989-826011 GGAAGGTTGTGTGCAGGAACGGG - Exonic
1142672977 17:1495942-1495964 GGCCGCTGCAGTGCAGGAACGGG - Intronic
1142931644 17:3290180-3290202 GGCATCAGGAGTGCTGGAATTGG + Intergenic
1144939552 17:18928596-18928618 GGCAGGTGCTGTGCAGGAAGAGG + Intronic
1145732746 17:27204327-27204349 GGCATCTGCTGGGCAGAACCTGG - Intergenic
1145928758 17:28668666-28668688 GGCATCTGGTCTGCAGGAGCTGG + Intronic
1146055525 17:29578888-29578910 GGCATTTGGTGTGCAGCATCTGG - Intronic
1146226544 17:31071466-31071488 GGCATCTGCTGGGCAGAACCTGG + Intergenic
1146938211 17:36825762-36825784 GACCCCTGGGGTGCAGGAACTGG + Intergenic
1148228268 17:45914629-45914651 GGCCTCTGGTGGGGAGAAACTGG + Intronic
1148619449 17:49023200-49023222 GGCATCTGGGGACCTGGAACTGG + Intronic
1152681948 17:81673001-81673023 GGTATTTGGTGTTCAGGGACAGG - Exonic
1152944436 17:83191323-83191345 GGCATCTGGTGTGAGGGAAGAGG + Intergenic
1155878999 18:31120656-31120678 GAGATCTGGTGTGCAGCAAAAGG - Intergenic
1156542658 18:37930288-37930310 GGCCTCTGCTGTGTGGGAACTGG - Intergenic
1156662095 18:39358305-39358327 GGCATTTTGTGTGAATGAACAGG - Intergenic
1156888333 18:42161263-42161285 AGCTTCTGTTGTGCAGGAGCTGG + Intergenic
1158478169 18:57798705-57798727 GGCTTCTACTGTGCAGGAAGAGG + Intronic
1160384048 18:78483689-78483711 GGCATCTGGTGGGTGGGACCAGG + Intergenic
1160710378 19:548670-548692 TGCTTCAGGTGTGCAGGGACGGG + Exonic
1160741024 19:685887-685909 GGCCCCTGGTGTGCAGGAACCGG - Exonic
1161469075 19:4447484-4447506 GGCAGCTGGCCTGCAGGAGCCGG - Intronic
1161497649 19:4596386-4596408 GGCATCAGGCGTTCCGGAACAGG + Intergenic
1162101304 19:8340813-8340835 TGCAGCTGGTGTGAAGGGACGGG - Intronic
1162901240 19:13796353-13796375 GGGATCTGGAGAGCAGGAATGGG - Intronic
1163303137 19:16460633-16460655 GGCTTCTGGAGTGGAGGAGCAGG - Intronic
1163681491 19:18684724-18684746 CGCATTTGGTGTGCAGGGGCAGG + Intronic
1163844006 19:19628413-19628435 CGCATGAGGTGTGCAGGTACCGG - Exonic
1166956608 19:46469494-46469516 GACATCTGGTGGGCAGGAGGTGG - Intronic
1168246266 19:55114337-55114359 GGCAATTGGGGTGCAGGAATGGG + Intronic
925021496 2:573122-573144 GGCCTCTGGTGTGTCGGAGCAGG - Intergenic
925204947 2:1997657-1997679 GGCTTCTGGTCCACAGGAACTGG - Intronic
925718560 2:6807073-6807095 GGCATAGGATGTGCAGGGACTGG + Intergenic
925958652 2:8994474-8994496 GGCTTCTGCTGTACAGAAACAGG + Intronic
926932756 2:18056805-18056827 GGTATCTGGTGTGGAGTGACTGG + Intronic
928819557 2:35343521-35343543 GGCATTTAGTCTGCAGGAATTGG - Intergenic
932415297 2:71569985-71570007 GGCACCTGGTGCTCAGGGACAGG + Intronic
933191911 2:79343648-79343670 GGGATTTGGATTGCAGGAACAGG + Intronic
934491032 2:94762169-94762191 GACATCTGGGGTGCAGGGAGAGG + Intergenic
934491233 2:94763039-94763061 GGCAGCTGGGGTGCAGGGATAGG - Intergenic
935417784 2:102837018-102837040 TGCAGCTGGTGTTCAGGCACAGG - Intronic
937285143 2:120745977-120745999 GGTCTCTGGTGTGCAAGACCTGG + Intronic
938142194 2:128803962-128803984 GACATGTGGTGTGCATGAATTGG - Intergenic
941976716 2:171413834-171413856 GATAAATGGTGTGCAGGAACAGG + Intronic
942094289 2:172523077-172523099 GGCATCTGGTGAACAGGGAGTGG + Intergenic
946538570 2:220658379-220658401 GGCATCTGGAGAGAAGGAAAAGG + Intergenic
947911967 2:233807559-233807581 GGCATCTGGTGGACAGGAGGAGG - Intronic
1169258056 20:4113717-4113739 GTCATCTGGTTTGCAGGTCCTGG + Intergenic
1170654279 20:18271449-18271471 AGCATCTTGGGTCCAGGAACAGG + Intergenic
1171217535 20:23362776-23362798 GGCTACTGGAGTGCAGGCACTGG - Intronic
1172571527 20:35974557-35974579 GGCGGCTGGAGTGCAGGATCAGG + Intronic
1172823418 20:37758990-37759012 GGCATTTGGTGTGAATGAAGGGG + Intronic
1173659069 20:44720410-44720432 GGCATCTGGTTTGAAGAATCTGG - Intronic
1174313360 20:49677134-49677156 GGCATCTGGTGAGCATGGGCTGG + Intronic
1175301107 20:57943378-57943400 GGCAGCTGGTGAACAGGAAGAGG - Intergenic
1176066049 20:63196017-63196039 GGCATGATGTGTGGAGGAACTGG - Exonic
1176169589 20:63690861-63690883 GGCCTCTGCCGGGCAGGAACTGG - Exonic
1176307493 21:5131566-5131588 GGCTGCTGGGGTGGAGGAACCGG - Intronic
1178685001 21:34703667-34703689 GGCGTGTGGTGAGGAGGAACTGG + Intronic
1178724985 21:35043322-35043344 GGCATCTGATGGGGAGGAGCAGG + Intronic
1178952001 21:36992866-36992888 GGCTGCTGGTCTGCAGGAAGGGG - Intergenic
1179164628 21:38925822-38925844 GGCATCTGGCAGGTAGGAACAGG + Intergenic
1179849567 21:44130464-44130486 GGCTGCTGGGGTGGAGGAACCGG + Intronic
1181086107 22:20440117-20440139 GGCCTCTGGTCTGCAGGGGCAGG - Intronic
1183094743 22:35545422-35545444 GGCATCTTGTGTAGAGGAAAAGG - Intronic
1183355147 22:37354806-37354828 AGCATCTGGTGGGAAGGCACCGG - Intergenic
1184986643 22:48140487-48140509 GGGGTCTGGTGTGCAGGCACAGG - Intergenic
1185016716 22:48347509-48347531 GGCATGTGGTGTGCAAACACAGG + Intergenic
1185249735 22:49794418-49794440 GGCCTCTGGTGAGCAGGGCCTGG - Intronic
950679196 3:14573418-14573440 GGATCCTGGTGTGCAGGAAGAGG + Intergenic
951620717 3:24599318-24599340 CACATCTGGTGTGCAGGACATGG + Intergenic
953322697 3:41986492-41986514 AGCATCTGGGGTGCTGGAATGGG - Intergenic
960005516 3:112777269-112777291 GGGATCTGGTGTGCAGGCAGTGG + Intronic
961532878 3:127550474-127550496 GGCATGGGGTGGTCAGGAACAGG + Intergenic
961749887 3:129088658-129088680 GGCTTCTGGGGTGGAGGGACGGG + Exonic
962314257 3:134349248-134349270 TGCATGTGGTGTGCATGAGCAGG + Intergenic
963295042 3:143537126-143537148 AGCATCTGGTGTCCAGCATCTGG + Intronic
967843999 3:194030254-194030276 GGCAGCTGGTGGGCAGGCTCAGG - Intergenic
969098983 4:4754890-4754912 GGCAGATGGCCTGCAGGAACGGG + Intergenic
969672311 4:8596539-8596561 GGCATATCGTGGGCAGGAGCAGG - Intronic
975243887 4:72095235-72095257 GTCTGCTGGTGTGCTGGAACTGG + Intronic
976329505 4:83813268-83813290 GGCATCTAGTGGGCAGAGACTGG - Intergenic
977415825 4:96732125-96732147 GGCACCTGGTATGCAGTAAATGG + Intergenic
986794361 5:11194252-11194274 GGCACCTGGGGTGCAGAAATGGG + Intronic
990627264 5:57628269-57628291 GGCATCTGGTGATGAGAAACCGG + Intergenic
991507489 5:67340455-67340477 GGCCTCTTGTGTGTAGGACCAGG - Intergenic
992540460 5:77759078-77759100 GGCATGAGGTGGGCAGGAAAGGG - Intronic
995096429 5:108240578-108240600 GACATCTGGTGTCTAGGGACTGG - Intronic
997027164 5:130078411-130078433 GGCAGCTGCTTTGCAGGGACCGG - Intronic
997264217 5:132485775-132485797 GGGATCTGGTGGGCTGGAACTGG - Intronic
998143694 5:139713536-139713558 AGCATGTGGGGTGCAGGAATAGG + Intergenic
998422140 5:141997509-141997531 GGGATCTGGTGTGCAAGCAGAGG + Intronic
1000986672 5:167868192-167868214 GGCTTCTGGTGGGTAGGGACAGG - Intronic
1002276812 5:178109225-178109247 GGCATCTGCTGTGCAGGTCCAGG + Intergenic
1003252438 6:4442060-4442082 TGCATCTGTTGTGGAGGAATGGG + Intergenic
1003844513 6:10159118-10159140 GGCATCTGGTGTGCTGCGCCAGG + Intronic
1004495084 6:16155589-16155611 GGGAACTGGAGTGCAGGCACTGG + Intergenic
1006473053 6:34238682-34238704 GGCCTCTGATGTTCAGAAACAGG + Intronic
1007935421 6:45728156-45728178 GGCATCTGAGATGCAGGCACTGG - Intergenic
1008511035 6:52276082-52276104 GGATTCTGCTGTGCAGGAATGGG + Intronic
1008903322 6:56648131-56648153 AGCATCTTTTGTGCAGGAAGAGG - Intronic
1016886946 6:148967687-148967709 GGCATGCGGTGTGCAGGGAAGGG - Intronic
1018246955 6:161832843-161832865 GGCATCTAGTGGGCAGGAGCGGG - Intronic
1021415583 7:20380068-20380090 GTCATCTGTTGTACCGGAACAGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023733688 7:43216563-43216585 GGCATCTGGGGAGCAGTACCAGG - Intronic
1023889478 7:44382053-44382075 GGCATTTGGTGTGGAGGAATGGG + Exonic
1029434392 7:100554204-100554226 GCCATCTGGGGTGCAGCAAAGGG - Exonic
1029498682 7:100913921-100913943 GGCATCTGGTATGTAGGATGGGG - Intergenic
1032146864 7:129391481-129391503 GGCATTTAGTGGGCAGGACCAGG - Intronic
1033452312 7:141472825-141472847 GACATCTGATGTGCATGAATGGG + Exonic
1033596978 7:142865598-142865620 GGCCTCTGGTGGGTCGGAACTGG - Exonic
1038065887 8:23963359-23963381 GGCATGTGGGGAGCAGGAAAAGG - Intergenic
1040532302 8:48275786-48275808 GGCATCTCCTTTGCAAGAACTGG + Intergenic
1042236735 8:66620780-66620802 GGCATTTAGTGTGCTGGGACTGG - Intergenic
1047300644 8:123611007-123611029 TGCATCTGGTTGGCTGGAACTGG + Intergenic
1049551762 8:143263259-143263281 GGAATCTGGTGTGCAGAGGCGGG + Intronic
1049772318 8:144389193-144389215 GGTATCTGTTGAGCAGGTACTGG - Intronic
1051268626 9:15333169-15333191 GGCATCTGGTATCCAGGAGATGG - Intergenic
1052880732 9:33599700-33599722 GACATCTGGGGTGCAGGGAGAGG - Intergenic
1053495238 9:38544510-38544532 GACATCTGGGGTGCAGGGAGGGG + Intronic
1053555547 9:39133128-39133150 GGCGTCTGCTGAGCAGAAACGGG + Exonic
1053666955 9:40323512-40323534 GACATCTGGGGTGCAGGGAGAGG - Intronic
1053916546 9:42948621-42948643 GACATCTGGGGTGCAGGGAGAGG - Intergenic
1054378105 9:64463540-64463562 GACATCTGGGGTGCAGGGAGAGG - Intergenic
1054517655 9:66052771-66052793 GACATCTGGGGTGCAGGGAGAGG + Intergenic
1055985780 9:82055919-82055941 GGCAGCTGGGGTGCAGGGAGAGG + Intergenic
1056585556 9:87925200-87925222 GGCAGCTGGGGTGCAGGGAGAGG - Intergenic
1056611322 9:88127744-88127766 GGCAGCTGGGGTGCAGGGAGAGG + Intergenic
1057094780 9:92295911-92295933 TTCATCTGGGGAGCAGGAACTGG + Intergenic
1057675336 9:97132738-97132760 GGCAGCTGGGGTGCAGGGAGAGG - Intergenic
1059306750 9:113359625-113359647 GGCATCTGGTGTAGGGGAATGGG + Intronic
1059651219 9:116318121-116318143 GGGCTCTGGAGAGCAGGAACTGG - Intronic
1060342042 9:122786114-122786136 GGCAATAGGTGTGCAGGAAGGGG - Intergenic
1061154000 9:128846119-128846141 AGCCACTGGTGTGCAGAAACTGG + Intronic
1061365039 9:130168237-130168259 GGCGTCTGGAGTTCAGGGACAGG - Intergenic
1061839214 9:133347927-133347949 GGCGTCTGGTGTGCGGGCGCTGG - Intronic
1185573360 X:1151833-1151855 GGCATCTGGGTTGCAGACACGGG - Intergenic
1185734163 X:2484922-2484944 GGCAGCTGGTGGGAAGGAGCCGG - Intronic
1185910694 X:3978101-3978123 GTCATCTGGTGTGTAGAAGCTGG + Intergenic
1190282505 X:48940293-48940315 GGAAGCTGGTGTACAGGAAATGG + Intronic
1190767512 X:53487852-53487874 GGCACTTGGTATGCAGGTACTGG - Intergenic
1191946878 X:66544200-66544222 GGCATCTGGGAGCCAGGAACTGG + Intergenic
1192138693 X:68630140-68630162 GGAATCTGGAGGGCAGGAATGGG - Intergenic
1192147090 X:68689153-68689175 GGAATCTGGAGGGCAGGAATGGG + Intronic
1193590583 X:83384376-83384398 GGCAGCTGGTGAGCAGGGATGGG - Intergenic
1194750273 X:97676725-97676747 GACATCTCGTGTTCATGAACTGG - Intergenic
1197576834 X:128223635-128223657 GGTATCTTGTGTGCCGTAACAGG - Intergenic
1197753001 X:129978642-129978664 TGCATGTGGTGTGCAGGAGTAGG + Intergenic
1199438288 X:147839524-147839546 CTCAACTGGTGTGCAGGAATAGG + Intergenic
1199666447 X:150100029-150100051 GGCATCTGTTTTCCAGGCACTGG + Intergenic
1200156801 X:153981015-153981037 GGCATCAGCTGACCAGGAACTGG + Intronic
1201636239 Y:16126237-16126259 GGCATCAGGGGTACAGGAAGAGG - Intergenic