ID: 902707139

View in Genome Browser
Species Human (GRCh38)
Location 1:18213378-18213400
Sequence TATGGAGCCAAGTCCTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902707139_902707141 -3 Left 902707139 1:18213378-18213400 CCATAGGAGGACTTGGCTCCATA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 902707141 1:18213398-18213420 ATACAGTCATTCAAGTACCCAGG 0: 1
1: 0
2: 4
3: 46
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902707139 Original CRISPR TATGGAGCCAAGTCCTCCTA TGG (reversed) Intronic
900951010 1:5858344-5858366 CATGGAGCCCAGTCCTCGTGGGG - Intergenic
902707139 1:18213378-18213400 TATGGAGCCAAGTCCTCCTATGG - Intronic
912985598 1:114426220-114426242 TATGGAGCCATTGCCTTCTAGGG + Intronic
915679616 1:157567937-157567959 TATGGCACCAAGGCCTGCTAGGG + Intergenic
920198485 1:204244987-204245009 TGAGGGGCCAAGTCCTCCTTGGG + Exonic
920575518 1:207057029-207057051 TAGGGAGCCAAAACCTCCGAAGG + Intronic
922768135 1:228166414-228166436 TGTTGAGCCAAGCCCTCCTCTGG - Intronic
923762011 1:236855449-236855471 AATGGAGGCCAGGCCTCCTATGG + Intronic
1063211025 10:3881474-3881496 AGAGGAGCCAAGTCCTGCTAAGG - Intergenic
1063569998 10:7206660-7206682 TGTGAAGCCAGGTCCTCATAAGG - Intronic
1076670876 10:132120567-132120589 CATGGAGCCAAGTACTCCCTGGG - Intronic
1077173047 11:1176835-1176857 TATGGTGCCAGGTCCCCCCAGGG + Intronic
1078759331 11:14239147-14239169 AATGGAGGCAAGTTCTCCTGAGG + Intronic
1079259212 11:18861824-18861846 CATACAGCCAAGTCCTACTATGG + Intergenic
1079261363 11:18885163-18885185 CATATAGCCAAGTCCTACTATGG + Intergenic
1083311639 11:61786753-61786775 TTGGGAGCCAAGCCCTCCCAGGG - Exonic
1087932153 11:103990389-103990411 TATGGAGCCCATTCCAGCTAGGG - Intronic
1091457534 12:618876-618898 TTTAGAGCCAAGGCCTCCAATGG + Intronic
1093735738 12:22618212-22618234 TTTAGAGCCAAGTCCTGCCATGG - Intergenic
1097610890 12:61818559-61818581 TATAGAGCAAAGCCCTCCAATGG + Intronic
1099585119 12:84505525-84505547 GATGGAGCCAAGGCCTTCTTTGG - Intergenic
1103455266 12:121060380-121060402 GATGGAGCCAAGTGCCCCTTGGG + Intergenic
1112690956 13:101893332-101893354 TCTGCAGCCAAGTGCTGCTATGG + Intronic
1114577691 14:23728769-23728791 TATGGAGCCCAGGCCTCTGATGG + Intergenic
1119099613 14:71867854-71867876 CAAGGAGCCAAGGCCTCCCAGGG + Intergenic
1119629046 14:76210026-76210048 GATGAAGCGAAGTCCTCCTCAGG + Exonic
1143204766 17:5133986-5134008 TATGGAGCCAAGTAAGCCTACGG + Exonic
1145760463 17:27422656-27422678 TATGGAGTCAAGTAAGCCTATGG + Intergenic
1145798581 17:27669642-27669664 TATGGAGTCAAGTAAGCCTATGG - Intergenic
1146160489 17:30556972-30556994 TATGGAACCAAGTAAGCCTATGG + Intergenic
1146472708 17:33137494-33137516 TTTGGAGCCAGTTCCTGCTATGG + Intronic
1151427765 17:74042247-74042269 TATGGAGCCAAGCCCTGACATGG + Intergenic
1156209209 18:34920476-34920498 TGTGAAGCCAAGTGCTCCGAAGG - Intergenic
1158628744 18:59093763-59093785 GAGGCTGCCAAGTCCTCCTAAGG + Intergenic
1163144948 19:15373758-15373780 TATGGACCCAAGCCCTCCCCCGG - Intronic
1164421449 19:28096877-28096899 TATGGGGCCAAGTCCCCTTAGGG + Intergenic
1164522914 19:28992547-28992569 TAGAGAGCCTACTCCTCCTAGGG + Intergenic
1166912978 19:46174026-46174048 TATGGAGTCAAGTCCTGGGAAGG + Intergenic
928683514 2:33726599-33726621 TGTGGCGCCACGTCCTCCCAAGG - Intergenic
929825209 2:45304617-45304639 TTTGGAGCTACATCCTCCTAGGG + Intergenic
931997680 2:67854737-67854759 TATGGATAAAAGTCCTTCTATGG - Intergenic
943093853 2:183405104-183405126 TATGGGACCAAGTCGTCCTAGGG + Intergenic
1169623326 20:7532988-7533010 TATAGATCCAAATCCACCTATGG - Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171218809 20:23374668-23374690 TGTGCTGCCAAGTCCTCCAAAGG + Exonic
1173210535 20:41028633-41028655 TAAGGAGCCGACTCCTCCCACGG - Intergenic
1174663121 20:52232837-52232859 TATGGAGCCATGTTCTCCTGGGG - Intergenic
1178255211 21:31046022-31046044 CATGCTGCCAAGTCCTCTTATGG - Intergenic
1179113693 21:38469975-38469997 TATGCAGCTATGTACTCCTATGG + Intronic
1180877420 22:19181105-19181127 TGGGGGGCCAAGTCCTCCTCTGG + Intronic
954847456 3:53572240-53572262 GATGGTGTCAAGTCCACCTAGGG + Intronic
959684463 3:109129635-109129657 AATGGAGCCAAGGCCTGCCATGG + Intergenic
960883846 3:122374358-122374380 TTTGGTTCCAGGTCCTCCTATGG + Intronic
973262451 4:48178639-48178661 CATGGAGCCAAGTCCCACCATGG + Intronic
985348174 4:189029137-189029159 TTTGAACCCAAGTCTTCCTATGG - Intergenic
986019931 5:3791565-3791587 TTTGGAGCTCAGTTCTCCTATGG + Intergenic
991516391 5:67440552-67440574 TATGGCACCAAGTTGTCCTAAGG - Intergenic
991640604 5:68747960-68747982 TATGCAGTCAAATCCTCCTGGGG - Intergenic
996302168 5:122001520-122001542 TAAGAAGCCAAGTCATCCTTTGG + Intronic
1002089667 5:176797112-176797134 TTTGGAGCCAAGTACTCCAGTGG - Intergenic
1004328994 6:14704289-14704311 TCTGAAGCCAAGTCCTCTTTCGG + Intergenic
1041871801 8:62643356-62643378 TATGTTGCCAACTCCTCCTTTGG - Intronic
1042504903 8:69549550-69549572 TAGGGAGACAAGTCCTGCTGGGG + Intronic
1048817453 8:138347164-138347186 TGAGGAGCCAGGTCCTCCTGGGG - Intronic
1049187356 8:141264193-141264215 TATGGATCCAAGGCCTCACACGG - Intronic
1199848718 X:151710187-151710209 TCTGGAGCCACCTCCTCCTTGGG + Intergenic