ID: 902707231

View in Genome Browser
Species Human (GRCh38)
Location 1:18213883-18213905
Sequence GGCCTTTGAAGTGTTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902707231_902707237 12 Left 902707231 1:18213883-18213905 CCCTGCCCAACACTTCAAAGGCC 0: 1
1: 0
2: 0
3: 14
4: 177
Right 902707237 1:18213918-18213940 GAGCAAGTCCTGCCCTTCTCTGG 0: 1
1: 0
2: 3
3: 25
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902707231 Original CRISPR GGCCTTTGAAGTGTTGGGCA GGG (reversed) Intronic
900405335 1:2490456-2490478 GTCCTGTGAGGTGTTGGGCTCGG + Intronic
902707231 1:18213883-18213905 GGCCTTTGAAGTGTTGGGCAGGG - Intronic
902746241 1:18476460-18476482 GGTATTTGACGTGTTGGGAATGG - Intergenic
902799562 1:18820870-18820892 GTGCTTGGAAGTGCTGGGCAGGG - Intergenic
902903177 1:19534223-19534245 GGACTTTGAAGGCTGGGGCAGGG + Intergenic
903124969 1:21241613-21241635 GGCTTTTGCCGTGTTGGCCAGGG + Intronic
903358694 1:22763530-22763552 GGCATTTGAAGTGGGGGGGAGGG - Intronic
904824257 1:33264347-33264369 GGTCTTTGGAATGTTGGGAAAGG + Intronic
905167442 1:36091311-36091333 GGCCTTTGACGAGGTGGACATGG + Exonic
906107837 1:43305353-43305375 GGCATTTGAACTGGTGGGGAGGG + Intronic
906379849 1:45325876-45325898 GGCCCTTGAAGGGTTAGGGAAGG - Intergenic
907576355 1:55529347-55529369 CGCCTTTGGGGTGTTGGGGATGG - Intergenic
909951339 1:81723485-81723507 TTCCTTTGAATTATTGGGCAGGG + Intronic
912567019 1:110594860-110594882 AGCCTATGAAGTGTAGGGCAAGG - Intronic
912869003 1:113286223-113286245 TACATTTGAAGTGTTGGGCCTGG - Intergenic
915731651 1:158058418-158058440 GGCCTTGGAAGCCTGGGGCAGGG - Intronic
917459679 1:175219192-175219214 GGACATGGAAGTGTTGGGGAGGG + Intergenic
917892901 1:179456522-179456544 GGCTATGGAAGTGTTGGACAGGG - Intronic
919888827 1:201955313-201955335 GGCCTTTGAGGACGTGGGCAGGG + Intergenic
1068540978 10:58294753-58294775 GACCTTTTAAGTCTTGGCCAAGG - Intergenic
1072660103 10:97358672-97358694 GGCCTGTCAAGTCTAGGGCAGGG - Intronic
1073134097 10:101210340-101210362 GGGCTTTGAACTGTGGGGCAGGG - Intergenic
1075588513 10:123674959-123674981 GGACTTTGAAGAGTAAGGCAGGG + Intronic
1076357070 10:129861063-129861085 GCCCTTTGAAGAGTGGGGCCGGG - Intronic
1076378494 10:130009238-130009260 CACATTTGAAGTCTTGGGCAGGG - Intergenic
1076908704 10:133376975-133376997 GGCCTTCCAGGTGTGGGGCATGG + Intergenic
1079794884 11:24788851-24788873 GGCCTTTGAATGCTTGGACAAGG + Intronic
1084870826 11:72097612-72097634 GGCCTTTGAAGCTCTGGCCAGGG - Exonic
1087587296 11:100138718-100138740 AGCCTTTCAAGTGTTGAGGAGGG + Intronic
1089330618 11:117686513-117686535 GGACTCTGCAGTGTAGGGCAGGG - Intronic
1089430174 11:118417120-118417142 GTCCTTTGCAGGGTTGGGGATGG + Intronic
1089643209 11:119861064-119861086 GGCCTTTGGAGTGATGGACTGGG + Intergenic
1090312125 11:125750381-125750403 GACCTTAGAAGTGTGGGGGAAGG + Intergenic
1092181495 12:6450031-6450053 GGCCTTTGCAGGGGTGGGAATGG + Intronic
1093487724 12:19670042-19670064 GACCTTTTAAAAGTTGGGCAGGG - Intronic
1097765590 12:63523219-63523241 AGCTTTTGAAGTGTTGAGGAAGG + Intergenic
1098039300 12:66337878-66337900 AGCCTTTCAAGGGTTGGGGAAGG + Intronic
1100253701 12:92859685-92859707 GGACTTTGGAGCGTTGGGTAGGG - Intronic
1100802232 12:98244340-98244362 GGCCGTTGAAGTCTGGGGCAAGG + Intergenic
1101491668 12:105215206-105215228 GGCATCTGAAGTGTGGGGGAGGG + Intronic
1102765194 12:115426888-115426910 GGCCTTTGAGGGCTGGGGCAAGG - Intergenic
1104626782 12:130363260-130363282 GGCCTTTGAGGTGATGGGAAGGG + Intronic
1110107106 13:71691247-71691269 AGCCTTTAAAGTGTTGGAAATGG - Intronic
1111308156 13:86443927-86443949 GGCCTTGGAAGTCATGGTCATGG + Intergenic
1113308166 13:109100987-109101009 TTCCTTTGATGTGTTTGGCAAGG + Intronic
1113881492 13:113629188-113629210 GGCCCATGCAGTGCTGGGCAAGG - Intronic
1118817498 14:69323591-69323613 GGCCTATGAATTGTGGGGGAGGG - Intronic
1130137573 15:81194991-81195013 GGACTATGGAGTGTTGGGCAGGG + Intronic
1130297406 15:82656904-82656926 GGCCTTGGAAGAGATGGGCTGGG + Intergenic
1131647234 15:94358559-94358581 GGACATTGAAGTGTGGGGAAAGG + Exonic
1131879171 15:96844237-96844259 GGCATTTGAGGTGGTGGGGAGGG + Intergenic
1132035916 15:98484551-98484573 GATCTTTGAAGTGTTGTGCCTGG + Intronic
1132387138 15:101408575-101408597 GGCCTTGGATGTGTTGGGGGAGG + Intronic
1132615943 16:841118-841140 GGCATTTGAGGTCTTGGGCCTGG + Intergenic
1133499593 16:6353482-6353504 TCCCTTTTAAGTGTAGGGCATGG + Intronic
1134464467 16:14462543-14462565 GGCCTTGGAAGTGTTATGCTGGG - Intronic
1135220149 16:20607389-20607411 TGCCTTTGAAGTATTGAGCCTGG - Intergenic
1136620994 16:31428194-31428216 GGCCTGTGAACAGGTGGGCAGGG + Intronic
1137489178 16:48916833-48916855 GCCTTTTGAAGTGTGGGGCCTGG + Intergenic
1139266596 16:65645600-65645622 GGCCTTTGACACTTTGGGCAGGG - Intergenic
1139372428 16:66477368-66477390 TGCCATTGTCGTGTTGGGCATGG - Intronic
1139673289 16:68506252-68506274 ACCCTTTGCTGTGTTGGGCATGG + Intergenic
1141889894 16:86919485-86919507 GGCCTTTGTAGAGATGGGAACGG + Intergenic
1141920682 16:87133574-87133596 GGCCTTGGTCGTGATGGGCAGGG + Intronic
1143541085 17:7569547-7569569 GGCCTTTGAATGGGAGGGCAGGG - Intronic
1144127704 17:12218298-12218320 TGCCTTTGATGGGCTGGGCAGGG + Intergenic
1148126590 17:45240644-45240666 GGCCTATGATGTGCTGGGCTGGG - Intronic
1148500428 17:48086553-48086575 GGCATTTAAAATGTTGGTCAGGG + Intronic
1148837105 17:50471142-50471164 GGACTTTGGAGTCTTGGTCAGGG - Intronic
1150710254 17:67525156-67525178 AGCCTTTGAAGTGTGGCCCATGG - Intronic
1151659077 17:75509217-75509239 GGCTCTTGAAGTGCTGGGGAGGG + Intronic
1203171583 17_GL000205v2_random:153398-153420 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1153951319 18:10060065-10060087 CGGCTTTGAAGTGTGGGGCTGGG + Intergenic
1154399144 18:14018543-14018565 GGCATGTGAAGTGCAGGGCAGGG + Intergenic
1155215062 18:23635908-23635930 GGGCTTTGAAGTGTGGGGAATGG + Intronic
1160739036 19:677477-677499 GGTGTTTGAGGGGTTGGGCAGGG + Intronic
1163744500 19:19037200-19037222 GGGCATTGAAGTGGAGGGCATGG + Intronic
1165406119 19:35632476-35632498 GGGCAATGAAGTGTTAGGCAAGG - Intronic
1166331607 19:42080988-42081010 TGCCTGTGAAGTGTGTGGCAAGG + Exonic
926150771 2:10424582-10424604 GCCCTCTGAAGAGGTGGGCAGGG - Intronic
926993813 2:18711635-18711657 GGCCTTTGAACTGGTTGGGAGGG + Intergenic
928010140 2:27599784-27599806 GCCCTTTGAATTGTTTGGGAGGG + Intronic
928111658 2:28515354-28515376 GGCCAGGGAAGTGGTGGGCAGGG - Intronic
931402980 2:61948974-61948996 AGCCATTGAAGTGCTGGGCACGG + Intronic
935021706 2:99238413-99238435 GGCCTCTGCAGTGTGGTGCAGGG - Intronic
935504172 2:103879367-103879389 AGCCTTTGGAGTTCTGGGCAGGG - Intergenic
939473143 2:142650961-142650983 GGCCTTTATTGTGTTGTGCATGG - Intergenic
939565411 2:143781203-143781225 GACCTTTGAAGTTTTAAGCAGGG + Intergenic
941431259 2:165417262-165417284 GGCCTCTCAGGTGATGGGCAGGG + Intergenic
945154197 2:206820903-206820925 TGCCTTTGAAGTGTTGTGGTTGG + Intergenic
946570691 2:221020873-221020895 TGCCTATGAAGTGCTTGGCATGG + Intergenic
947411898 2:229850450-229850472 GCTCTGTGAAGAGTTGGGCAGGG - Intronic
948208079 2:236173294-236173316 AGCCCTTGGAGTGTTGGGGAGGG + Intergenic
1168750022 20:275775-275797 GGCCTTTGCAGAGATGGGAAAGG + Intronic
1168869386 20:1115543-1115565 GGGCTTTCAAGGGGTGGGCATGG - Intronic
1169318075 20:4609530-4609552 GGCCTGAGAAGTGTTGGGGGAGG - Intergenic
1169696548 20:8393691-8393713 AGCTTTTGATGTGTTGGACATGG + Intronic
1170201449 20:13748875-13748897 AGCCTTTGAGGGGCTGGGCATGG - Intronic
1172131516 20:32659229-32659251 TGTCTTTGGAGTGTGGGGCAAGG - Intergenic
1174364266 20:50047013-50047035 AGGCTTTGAAGGGCTGGGCAAGG - Intergenic
1175723136 20:61299688-61299710 GGCCTTTCAAGGGTGAGGCATGG - Intronic
1176327559 21:5515229-5515251 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1176400198 21:6305722-6305744 TGGCTTTGAAGTCTTGGGGAAGG - Intergenic
1176436959 21:6683382-6683404 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1176461221 21:7010452-7010474 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1176484782 21:7392230-7392252 TGGCTTTGAAGTCTTGGGGAAGG + Intergenic
1177364520 21:20117129-20117151 GGTTTTTCAAGTGATGGGCAGGG + Intergenic
1180987755 22:19915397-19915419 GGCCTCTGAACTGCTGGCCAAGG - Intronic
1183137522 22:35903489-35903511 GGTATTTGAAGTGATGGGAATGG - Intronic
1184257426 22:43295194-43295216 GGGCTTTGGAGAGGTGGGCATGG - Intronic
1184491290 22:44810659-44810681 TGCCTGTGGAGTGGTGGGCAGGG + Intronic
952904797 3:38132647-38132669 GGGCTTTGTACTGTTGGCCAAGG - Intronic
953794828 3:45976553-45976575 GACCTTTGAAGGGGTGGGGAGGG - Intronic
954371559 3:50171784-50171806 CGCCTCTGAAGTCCTGGGCAGGG - Intronic
954701578 3:52453444-52453466 GGGCTTTGAAGTTTGAGGCAGGG - Intronic
955619608 3:60848474-60848496 CATCTTTGAAGTTTTGGGCATGG - Intronic
960470509 3:118059341-118059363 GGCCTATGAAATGTGGAGCAGGG - Intergenic
962296385 3:134192235-134192257 GGCAATTGAAGTGGTGGTCATGG - Intronic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
966802896 3:183781247-183781269 GGCCTGCGAACTGGTGGGCATGG + Intronic
969367690 4:6708344-6708366 TGTTTTTGAAATGTTGGGCATGG - Exonic
969388848 4:6875610-6875632 GTCCTTTGGGGTGTTGTGCAAGG + Intronic
970244762 4:14048937-14048959 GGCCTTTGCAGTGATTGTCAAGG + Intergenic
970607564 4:17694853-17694875 GGGCTCTGCAGTGTTGGGGAAGG + Intronic
972663607 4:41142551-41142573 GAACTTTGAAGGGTGGGGCATGG - Intronic
978921447 4:114188015-114188037 GGCCTTTGCAGAATTAGGCATGG - Intergenic
983793844 4:171834491-171834513 GGCATTTGAAGTGTTTACCAGGG - Intronic
986424464 5:7616815-7616837 GGCCTTTGAAGAGGTGGCTAAGG + Intronic
988241290 5:28612550-28612572 GGCCTCTGAGGTGTAGGGTAAGG - Intergenic
991530785 5:67611715-67611737 GGCCTTTTAAGATTTGGACAGGG - Intergenic
995558559 5:113356037-113356059 GTCCTTTGAAGTGACAGGCAAGG + Intronic
998112585 5:139513673-139513695 GGCCTGAGAAGTGATGGGCTGGG - Intergenic
1001861803 5:175062353-175062375 GGCCTTAGAAGTTTTGGACTGGG - Intergenic
1002323061 5:178387189-178387211 GGCCATTGAAGACTCGGGCAGGG - Intronic
1003518028 6:6833917-6833939 GTCCTTGGAAGTGCTGGCCAAGG + Intergenic
1003572006 6:7261994-7262016 GCCATTGGAGGTGTTGGGCAGGG - Intergenic
1004406803 6:15340225-15340247 TGCCTTTGAAGTGCTGAGCATGG + Intronic
1009357428 6:62768616-62768638 CGGCTTTGAAGTGTTGTTCATGG + Intergenic
1010518443 6:76803115-76803137 GGCTTATCAGGTGTTGGGCAAGG + Intergenic
1014078337 6:117263391-117263413 GGGCTTGGCAGTGTTGTGCAGGG - Intergenic
1016443733 6:144111085-144111107 AGCCTTTGAAGTGCTGTGGAAGG + Intergenic
1017148016 6:151252148-151252170 GGCTTTTGGAGTATTGGGCAAGG + Intronic
1017292138 6:152750778-152750800 GGGCTTTGAAATGCTGGTCAGGG + Exonic
1017966277 6:159269824-159269846 GGCCTTTGAATGATTGGACAAGG + Intronic
1018290454 6:162287862-162287884 AGCCTTTGAAATGATTGGCATGG - Intronic
1019800735 7:3086382-3086404 GGACTTTGAAGTGTTGAGGTAGG - Intergenic
1019930229 7:4217758-4217780 AGGCTTTGTAGTGCTGGGCATGG + Intronic
1022349511 7:29554424-29554446 GGAATTAGAAGTGTTGGGCCAGG + Intergenic
1022922916 7:35034597-35034619 GGTCTTTCCACTGTTGGGCAGGG - Intronic
1024303253 7:47904124-47904146 GGCCTGTGATGTGGTGGGGATGG - Intronic
1024581642 7:50805480-50805502 GTCCTTTGAAGGGCTGGGCAGGG + Intergenic
1025320723 7:58090564-58090586 GGCCTTTGTAGTGGTGGGGTAGG - Intergenic
1027619311 7:80463719-80463741 TGCCTGTTATGTGTTGGGCATGG - Intronic
1028996346 7:97104794-97104816 GGCCTTTGAAGTGGTTAGAATGG + Intergenic
1029117475 7:98244734-98244756 GGCATTTGAAGAGCTGGGGAAGG + Intronic
1029124425 7:98286921-98286943 GGCGTTTGAAGTTGTGGGTACGG + Intronic
1030988116 7:116265943-116265965 CTCCTTTGCAGTGTTGTGCATGG + Intergenic
1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG + Intronic
1035780561 8:2224182-2224204 GGCCTTTAAAGAGTTGAGTAAGG + Intergenic
1036472908 8:9066521-9066543 GGCCTTTGGGTTGTTGGGCACGG + Intronic
1038015899 8:23514489-23514511 AGCCTTTGAAGAGTTGGGGTGGG - Intergenic
1038286527 8:26210660-26210682 GGTCTTTGAGGTGGTGGGCAGGG - Intergenic
1038563318 8:28599065-28599087 TTCCTTTGAATTATTGGGCAGGG - Intergenic
1039887397 8:41662839-41662861 TGCCTGTCAAGTGTGGGGCACGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1048794100 8:138132686-138132708 GGTGTTGGCAGTGTTGGGCAGGG + Exonic
1055639444 9:78308161-78308183 GGACTTTGCAGTGATGGGCTTGG + Intronic
1056453241 9:86736801-86736823 GACATTTGAGGTGTTGGGCAGGG - Intergenic
1058305061 9:103429939-103429961 GGCCATTTGATTGTTGGGCAAGG + Intergenic
1203434551 Un_GL000195v1:125278-125300 TGGCTTTGAAGTCTTGGGGAAGG - Intergenic
1186532928 X:10315543-10315565 GACCTATGAAGTGTTGGACCTGG - Intergenic
1186594982 X:10971157-10971179 CTGCTCTGAAGTGTTGGGCAAGG - Intergenic
1187473415 X:19589113-19589135 TGCCTTTGAGCTGTTGGGAAGGG - Intronic
1187853134 X:23610800-23610822 GGCCTTTGGAGCCTTTGGCAAGG - Intergenic
1190845458 X:54186709-54186731 GTCCTTTGAAATGTAGGGTAGGG - Intergenic
1192423298 X:71053111-71053133 GGCCGTTGAAGTCATGGGCCTGG - Intergenic
1193077456 X:77370192-77370214 AGCCTTGGGAGTGTTGGGCTTGG - Intergenic
1194221602 X:91200279-91200301 GGCCATTGACGGGTTGGACAAGG + Intergenic
1195593591 X:106661515-106661537 GGCCATTTAGGGGTTGGGCATGG - Intronic
1199764384 X:150930324-150930346 GTCCTTTGAAGAGGTGGGCGGGG - Intergenic
1200684335 Y:6246000-6246022 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1200686979 Y:6266324-6266346 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1200831177 Y:7689781-7689803 GGCCTTTGGAATTGTGGGCATGG + Intergenic
1200989857 Y:9337241-9337263 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1200992525 Y:9357574-9357596 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1200995177 Y:9377852-9377874 GGCCTTTGGAATTGTGGGCATGG - Intronic
1200997842 Y:9398198-9398220 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1201000351 Y:9466731-9466753 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1201003013 Y:9487044-9487066 GGCCTTTGGAATTGTGGGCATGG - Intronic
1201005672 Y:9507327-9507349 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1201008332 Y:9527657-9527679 GGCCTTTGGAATTGTGGGCATGG - Intergenic
1201048299 Y:9908386-9908408 GGCCTTTGGAATTGTGGGCATGG + Intergenic