ID: 902709530

View in Genome Browser
Species Human (GRCh38)
Location 1:18229196-18229218
Sequence CTGGAGGAAGTGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 0, 2: 9, 3: 62, 4: 600}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902709523_902709530 25 Left 902709523 1:18229148-18229170 CCTTTCTTCAAATGAAACGGATG 0: 1
1: 0
2: 0
3: 5
4: 131
Right 902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG 0: 1
1: 0
2: 9
3: 62
4: 600
902709522_902709530 26 Left 902709522 1:18229147-18229169 CCCTTTCTTCAAATGAAACGGAT 0: 1
1: 0
2: 2
3: 17
4: 205
Right 902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG 0: 1
1: 0
2: 9
3: 62
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902709530 Original CRISPR CTGGAGGAAGTGATGGAGCA TGG Intronic
900561558 1:3309610-3309632 CTGGAGAAGGTGCTGGAGCGGGG + Intronic
901013312 1:6213066-6213088 CTGGAGAAGGTCATGGAGCTGGG - Exonic
901083204 1:6595210-6595232 CAGAAGGAAGTGAGGGAGCAAGG - Intronic
901098811 1:6703347-6703369 CTGGAAGAGCTGATGGACCATGG - Intergenic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901821554 1:11833612-11833634 CTGGTGGAAGAGCTGGAGGATGG - Exonic
902709530 1:18229196-18229218 CTGGAGGAAGTGATGGAGCATGG + Intronic
902780238 1:18700261-18700283 CTGGAGGAGGTGGTCAAGCAGGG + Intronic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
904008742 1:27378012-27378034 TTGGCGGAAGTGAAGGTGCAAGG + Intergenic
904091280 1:27946637-27946659 CTGCAGGAGGTGGTGGAGCAGGG + Intronic
904282714 1:29432627-29432649 GTGGAGGTAGACATGGAGCAAGG + Intergenic
904391013 1:30186009-30186031 CTGGCGGGCGTGATGGAGCATGG - Intergenic
905452902 1:38068453-38068475 CTGGTGGGAGGGAGGGAGCAAGG + Intergenic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906132204 1:43467284-43467306 CTGGATCAAGTGATGGAAGAAGG - Intergenic
907475750 1:54704220-54704242 CTGGAGGAAGTGCTTGGCCAGGG + Intronic
908616192 1:65925524-65925546 GAGGAGGTAGTGATGGGGCAGGG - Intronic
908618466 1:65949331-65949353 CTGTAGCAAATGATGGAGGAAGG - Intronic
909107645 1:71432717-71432739 CTGGATGAATTGTTGGATCAAGG - Intronic
909416410 1:75410965-75410987 CTTGAGGTAGTGATAGTGCATGG + Intronic
910568627 1:88675529-88675551 CTGTAGGAAGAGTTGTAGCAAGG + Intergenic
911630525 1:100178832-100178854 CTGGAGGCAGGGATGGTGGAAGG - Intergenic
912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG + Intronic
912402392 1:109405911-109405933 CTGGAAGTAGGGATGGAGAAGGG + Intronic
912540108 1:110408141-110408163 CTAAAGGACGAGATGGAGCAAGG + Intergenic
912864890 1:113248139-113248161 CTGGAGGGAGTGATGAGGCTCGG + Intergenic
913199337 1:116483527-116483549 CTGGAGGATGTGAAGGGTCATGG - Intergenic
913500833 1:119471269-119471291 CCTGAGGAGGAGATGGAGCAAGG + Intergenic
913707542 1:121441835-121441857 ATGGAGGAAGGGATGGAAAAGGG - Intergenic
914038120 1:144022593-144022615 GTGAAGGAAGTGATGGAGGGAGG - Intergenic
914394728 1:147254399-147254421 TGGGAGGAAGTGAGGGAGGAAGG + Intronic
914848827 1:151298915-151298937 CTGTAGGAAGTAATCGAGCAAGG + Exonic
915334207 1:155131129-155131151 CAGGAGACAGTGATGGTGCAGGG + Intronic
915645100 1:157264876-157264898 CTGGAGGAAGTGAGGGAGCCTGG + Intergenic
915883770 1:159701582-159701604 CTTGAGGGTGAGATGGAGCAGGG + Intergenic
916255767 1:162786645-162786667 CCTGGGGAAGTGATGGGGCATGG + Exonic
916477963 1:165187549-165187571 CTGGAGGAAGTGGTGGTCTAGGG + Intergenic
916681363 1:167108155-167108177 CTGGATGAATGGATGGACCATGG - Intronic
916713994 1:167434908-167434930 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916713999 1:167434920-167434942 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714007 1:167434945-167434967 CCGGAGGAAGGGCTGGAGGAGGG - Intronic
916714016 1:167434970-167434992 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714021 1:167434982-167435004 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714029 1:167435007-167435029 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714034 1:167435019-167435041 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714042 1:167435044-167435066 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714047 1:167435056-167435078 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916714068 1:167435118-167435140 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714073 1:167435130-167435152 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714081 1:167435155-167435177 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714086 1:167435167-167435189 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714094 1:167435192-167435214 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714099 1:167435204-167435226 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714107 1:167435229-167435251 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714112 1:167435241-167435263 CCGGAGGAAGGGCTGGAGGAAGG - Intronic
916714120 1:167435266-167435288 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714132 1:167435303-167435325 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
916714144 1:167435340-167435362 TTGGAGGAAGGGCTGGAGGAGGG - Intronic
917135251 1:171782884-171782906 CTGGAGGTAGGGAAGGAGGAAGG + Intronic
917594910 1:176519391-176519413 CTGGTGGAAGTGAAGGAGGCAGG + Intronic
917609680 1:176674406-176674428 CAGGAGGAAGTGTGGGAGCAGGG - Intronic
917826405 1:178825892-178825914 CTGGAGGATTTTAGGGAGCAGGG + Intronic
918040050 1:180908412-180908434 CTGGAGGAAGTGATGAGGGCAGG + Intergenic
919818565 1:201457971-201457993 TTGGTGGCAGTGATGGAGAAGGG - Intergenic
919849960 1:201665991-201666013 GTAAAGGAAGTGAAGGAGCAGGG + Intronic
919880129 1:201895585-201895607 CTCCAGGAAGTGATGGAGGGTGG + Intergenic
919956537 1:202422717-202422739 CTGGAGCAAGTAAAGAAGCAAGG + Exonic
920166457 1:204039674-204039696 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
920372288 1:205486737-205486759 CTGGAAGAAGAAATGGAACAAGG - Intergenic
920647845 1:207816303-207816325 GAGGAGGAAGTGGTGGAGGAAGG + Intergenic
920691552 1:208150734-208150756 CTGTAGGAAGGCATGGAGCAGGG - Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920860126 1:209699106-209699128 CAGGAGGAAGGGAAGGAGGAGGG + Intronic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414045 1:225403928-225403950 CTGGAGGTACTGGTGGAGCCAGG - Intronic
922874338 1:228928149-228928171 CTGGGGGAAGAGAGGGAGCCCGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923048014 1:230369574-230369596 ATGGGGGAAGAGATGGAGCCAGG - Intronic
923608189 1:235464468-235464490 GGGGAGGAAGTGAGGGAGGAAGG - Intronic
923736643 1:236615518-236615540 TTGGAGCAAGTGATGGAGTTTGG + Intergenic
923784478 1:237054243-237054265 AGGGAGGAAGTGATGGATAAAGG - Intronic
924553223 1:245097772-245097794 CTGAAGGAAATGAAGGGGCATGG + Intronic
924565877 1:245198043-245198065 TAGGAGGAAGGGAGGGAGCAGGG - Intronic
1063073764 10:2693409-2693431 TTGGAGGAAGTAATGAAGTACGG - Intergenic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1063896115 10:10684113-10684135 CGGGATGAAGGGATGAAGCACGG + Intergenic
1063974502 10:11404719-11404741 CAGGAGCCTGTGATGGAGCAGGG - Intergenic
1064001606 10:11668197-11668219 CTGGAAGAAGGGATGGAAAAGGG + Intergenic
1064066334 10:12185224-12185246 CTGGGGGAAGGGGTGGGGCATGG + Intronic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1064346749 10:14539839-14539861 GTAGAGGAAGTGAGGGTGCAGGG - Intronic
1064755228 10:18567139-18567161 ATGGAGGATGTAATGGAGAATGG - Intronic
1064985674 10:21207642-21207664 CTGCAGGAGATCATGGAGCAGGG + Intergenic
1065268194 10:23999338-23999360 CTGGAGGCAGTGTTGGACCCTGG + Intronic
1066047581 10:31606696-31606718 GTGGTGGAAGTGATGGAACAAGG - Intergenic
1066722230 10:38352314-38352336 CCTGGGGAAGTGATGGGGCATGG + Intergenic
1067193229 10:44090199-44090221 TTGGCGGAAGTGATGGATCCTGG - Intergenic
1068813504 10:61283326-61283348 CGGGAGGAAGTGATGGTGGAGGG + Intergenic
1069948049 10:72000909-72000931 AGGGAGGAGGTGATGCAGCATGG + Intronic
1070469412 10:76764018-76764040 ATGGAAGAAGGGAAGGAGCAAGG + Intergenic
1070729239 10:78813877-78813899 ATGGAGCAAGTGCTGCAGCAGGG - Intergenic
1071304533 10:84286818-84286840 CTGGAGTTAGGGATGGAGTAGGG + Intergenic
1071564985 10:86667090-86667112 GTGAAGGAAGTGATTAAGCAGGG + Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073249127 10:102111145-102111167 CTGGAGGAAGTGAAGGAGAGAGG + Intronic
1073650648 10:105354579-105354601 CATGAGGAAGTGATGGAGAGAGG + Intergenic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1073994159 10:109296144-109296166 CAGGAAGATGTGAGGGAGCAGGG - Intergenic
1074788113 10:116859607-116859629 CTGTTGGAAGGCATGGAGCAAGG - Intronic
1075518530 10:123129374-123129396 CTGGAGGAGGTGATCAACCAGGG - Intergenic
1076330068 10:129657625-129657647 CTGGAGGAGGAGCTGGAGCTGGG + Intronic
1076744871 10:132507774-132507796 CTGGAGCCAGGGATGGGGCAAGG + Intergenic
1076928512 10:133508972-133508994 CAGGAGGAAGAGAGGGAGAAAGG + Intergenic
1077086170 11:752445-752467 CTGGAGGAAGGAATGTTGCACGG + Intronic
1077247069 11:1544827-1544849 CAGGAAGCAGTGAAGGAGCAGGG + Intergenic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1078094295 11:8287132-8287154 CTGGATGAAGTGATGGGTCCAGG - Intergenic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078955465 11:16189254-16189276 CTAGACGAAGAGTTGGAGCATGG + Intronic
1079456746 11:20642973-20642995 CTGTAGGAAGGGGTGGATCATGG - Intronic
1081547282 11:44080369-44080391 CTTGAGGAGTTGATGGAGCATGG + Intronic
1082045711 11:47724593-47724615 CAGGAGGAGGTGGTGGAGGAGGG + Exonic
1082109896 11:48262923-48262945 TTGGAGGAAGGTATGGAGAAGGG + Intergenic
1082894174 11:58172603-58172625 CTCCAGAAAGTGATGGAGCCAGG + Intronic
1082898841 11:58223532-58223554 CTGGATGAAGGGAATGAGCAGGG + Intergenic
1082967094 11:58977310-58977332 CTGCAGGAAGTGATACAGCATGG + Intronic
1083181135 11:60986397-60986419 ATGGCGGAAGTGGTGGAGCCTGG - Intronic
1083612684 11:64011655-64011677 CGGGACGAAGACATGGAGCAGGG + Intronic
1083735966 11:64681467-64681489 CTGGAGGAAGGGATCAAGGAAGG + Intronic
1084672322 11:70614667-70614689 CTGGAGGATGGGATGAAGGAAGG - Intronic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1087066161 11:94029896-94029918 CTTGTGGAGGTGATGGAGAAAGG + Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1088357350 11:108957823-108957845 CTGCCTGAAGTCATGGAGCAGGG + Intergenic
1088821192 11:113458893-113458915 CTGGGGGCAGCGATGGGGCAGGG + Intronic
1088972004 11:114781761-114781783 CTGGTGGAGGTGAAGGAGGAAGG - Intergenic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089958759 11:122597249-122597271 ATGGAGGGAGGGATGGAGGAAGG + Intergenic
1091396079 12:154967-154989 CTGGAGGAGGTGAACCAGCATGG - Intronic
1091449930 12:566042-566064 CTGAAGGCGGTGCTGGAGCAGGG - Exonic
1091545882 12:1501028-1501050 CTGGAGGTGGTCTTGGAGCAGGG - Intergenic
1091848413 12:3676034-3676056 TTGGTGGAAGTGATGGAGCAAGG - Intronic
1092260393 12:6950498-6950520 CTGGTGGGAGTGCTGGGGCAGGG + Intronic
1092655563 12:10680835-10680857 CTGAAGGAAGTGATGGTGGTGGG - Intergenic
1093101888 12:15037982-15038004 CTGGAAGAATTCAGGGAGCAAGG + Intergenic
1093151909 12:15631601-15631623 TTGGAGGAGGTGATGGAGCAGGG + Exonic
1093375956 12:18428545-18428567 CAGGTGGAAGTTGTGGAGCAGGG - Intronic
1094275031 12:28664747-28664769 CAGGATGAAGAGATGAAGCACGG + Intergenic
1095166079 12:38973644-38973666 CTGGAGGAATTGCTGGAGAGAGG - Intergenic
1095675028 12:44906696-44906718 CTAGAGGAAGAGATGGAGAAAGG + Intronic
1096101248 12:48971628-48971650 CGGGAGGAAGGGAGGGAGGAAGG + Exonic
1096774761 12:53957093-53957115 CTGGAGGAAGTGGGGAACCAAGG + Exonic
1097456571 12:59805944-59805966 TTGGTGGAAGTGATGGTGAAAGG - Intergenic
1097824136 12:64157221-64157243 CTGTAGGAAGAGCTGAAGCAGGG + Exonic
1099047910 12:77746600-77746622 TTGGAGGAAGAGATGGAGAAAGG + Intergenic
1099102305 12:78458165-78458187 CAGGAGGAAGTGAGAGAGAAGGG - Intergenic
1099394551 12:82121445-82121467 CTGGTGGCAGTGTTGGTGCAGGG - Intergenic
1100596720 12:96078334-96078356 CTGGAAAATGTGATGGAGGAGGG + Intergenic
1101772881 12:107767678-107767700 CTGGAGGAAGGAATGCTGCATGG - Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102028386 12:109726436-109726458 CAGCAGGAAGTGGTGGAGCCAGG + Intronic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102526569 12:113516239-113516261 ATGGAGGAAGGGATGGAGGGAGG - Intergenic
1102526574 12:113516251-113516273 ATGGAGGAAGGGATGGAGGAAGG - Intergenic
1102526578 12:113516263-113516285 AGGGAGGAAGGGATGGAGGAAGG - Intergenic
1102545750 12:113654048-113654070 CTGGAGGATGTCTTAGAGCAGGG + Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102677151 12:114666557-114666579 CTGGGGGAAATTATGGAGCCAGG - Intergenic
1102728339 12:115086097-115086119 CTAAAGTAAGTGACGGAGCAGGG + Intergenic
1102922795 12:116805169-116805191 ATAGAGGAAGTGATGGAGCCAGG - Intronic
1103961969 12:124614540-124614562 CTTGAGGAAGTGAGGGAGCGTGG - Intergenic
1105304926 13:19161594-19161616 CTGGAGGAGGTGGGGGAGTAGGG + Intergenic
1105821986 13:24087966-24087988 CTGGAGGAGATGCTGGAGGAAGG - Intronic
1106316386 13:28597779-28597801 CTTTAGGAAATGATGGAGCCAGG + Intergenic
1106577855 13:30992609-30992631 CTGGTGGAAGTGTGGGAGGAGGG + Intergenic
1106720555 13:32430640-32430662 CTAGAGGAAGTGAGAGGGCATGG + Intergenic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107230127 13:38098934-38098956 CTGGAGCAAGAGAGAGAGCAGGG + Intergenic
1107259508 13:38473399-38473421 GTGGTGGAAGTGACGGTGCATGG - Intergenic
1107610439 13:42107535-42107557 CTGGAGGGAGGGAGGGAGTATGG + Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108642465 13:52395525-52395547 CTGGAGGCAGGGAACGAGCAGGG + Intronic
1109512317 13:63394343-63394365 ATGGAGGAAGGGAGGAAGCAAGG + Intergenic
1109535874 13:63718739-63718761 CTGGAGGAAGTGAAGAAAGAGGG + Intergenic
1109540227 13:63767547-63767569 CTGGAGGAAGTGAAGAAAGAGGG - Intergenic
1110240628 13:73262501-73262523 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1110392714 13:74993939-74993961 ATGGAGGTAGTAATGGAGTAAGG - Intergenic
1110495315 13:76161344-76161366 CTGGAGTCAGTCATGGAGTAAGG - Intergenic
1110706911 13:78607716-78607738 ATGGAGGAAGGAATGGAGAAAGG + Intergenic
1111317943 13:86585539-86585561 CAGGAGGAAGAGAGGGAGAAAGG - Intergenic
1111419990 13:87999337-87999359 CAGGAGGAAGTGAGAGAGCAGGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1112962168 13:105139942-105139964 ATTGAGGAAGTGCTGCAGCATGG - Intergenic
1113736224 13:112680520-112680542 CTGAAGGAAGAGATGGACCTGGG + Intronic
1113908402 13:113830723-113830745 CTGGAGGGAGTGGTGTTGCAGGG - Intronic
1117690111 14:58298001-58298023 CTGGAGGAAACGGTGGAGGACGG + Intronic
1118312185 14:64702454-64702476 CTGGAAGCAGTGATGGTGAAGGG + Intergenic
1118636527 14:67753248-67753270 CTGGAGCAGGGGCTGGAGCAGGG - Intronic
1119119802 14:72064172-72064194 CTGGAAGAGGTGAAGGAGGAGGG + Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1121115391 14:91339389-91339411 CTGGAGGACTTGATGGGGCTGGG + Exonic
1121125541 14:91404338-91404360 CTGGTGTATGTGATGGAGAAGGG + Intronic
1121288250 14:92753388-92753410 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1121511364 14:94515435-94515457 CTAGAGGCAGTGAAGGAGCAGGG + Intronic
1121618533 14:95330503-95330525 AGGGAGGAAGTGGTGGAGCTGGG - Intergenic
1121840405 14:97129434-97129456 CTGGTGGAGGGGATGGATCATGG - Intergenic
1122069189 14:99194708-99194730 CTACAGGAAGTGAAGGAGCTGGG + Intronic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1122923326 14:104888846-104888868 CTGGAGGAAGGGGTGGGGCGGGG + Intronic
1123014376 14:105366786-105366808 GTGGAGGCAGGGTTGGAGCAGGG + Intronic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1123131896 14:105994069-105994091 CTGGAGGAGGTGTTGGCTCAGGG + Intergenic
1202836446 14_GL000009v2_random:80615-80637 CTGGAGGTAGTGTTGGTTCAGGG - Intergenic
1124085344 15:26544649-26544671 CTGTAGGGAGTTATGTAGCAGGG + Exonic
1124692052 15:31831952-31831974 CTGGCGGAAGGGCTGGGGCAGGG + Intronic
1125894176 15:43288061-43288083 CTGGAGGACTTGAAGAAGCAGGG + Intronic
1126443872 15:48720216-48720238 CTGGAGGAAGGGAAGGAGTGAGG + Intronic
1127099824 15:55553155-55553177 CTGTGAGAAGTGATGGATCAGGG - Intronic
1128243095 15:66114932-66114954 AAGGAGGAAGAGATGGAACAGGG - Intronic
1128354074 15:66912171-66912193 ATGTAGGAAGTGGTGGAGCTGGG + Intergenic
1129722399 15:77884926-77884948 CTGAAGAAAGTCATGGACCAGGG - Intergenic
1129768056 15:78182593-78182615 ATGGAGGAATTCATGGAGCTGGG - Exonic
1129921522 15:79323114-79323136 CAGAAGGAAATGATGGAGCAGGG - Intronic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1131869170 15:96743894-96743916 CTTGTGGAAGGGATGGAGGAAGG + Intergenic
1132238488 15:100239597-100239619 CAGGAGGAAGTGTTGGAGACGGG + Intronic
1132318854 15:100910345-100910367 GTGTAAGAAGTGATGAAGCAGGG - Intronic
1132483441 16:177642-177664 CGGGAGGAGGGGATGGAGGAGGG + Intergenic
1132679789 16:1134989-1135011 CAGAAGGAGTTGATGGAGCACGG - Intergenic
1133031677 16:3014090-3014112 AAGGAGGTTGTGATGGAGCAGGG - Exonic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133706384 16:8358845-8358867 CAGGAGGAAGTGTTGGAGAGGGG - Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134195899 16:12158731-12158753 CGGCAGGAAATGAGGGAGCAGGG - Intronic
1135064937 16:19301467-19301489 AGGTAGGAAGTGATGGAGCTGGG - Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137908434 16:52350841-52350863 TTGGTGGAAGTTCTGGAGCAGGG - Intergenic
1138148997 16:54637793-54637815 CTGGCAGAAGTAGTGGAGCAAGG - Intergenic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138306578 16:55982161-55982183 GTGGGGGAAGGGATGGAGCGGGG - Intergenic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1140202212 16:72903903-72903925 GAGGAGGAAGCGATGGAGCCTGG - Intronic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1141017597 16:80465213-80465235 CTCAAGGAAGGGATGGAGGAAGG - Intergenic
1141671246 16:85492869-85492891 CTGGAGCAGGTGACAGAGCAGGG + Intergenic
1141991945 16:87615587-87615609 AAGTGGGAAGTGATGGAGCAGGG + Intronic
1142212797 16:88816417-88816439 CTGGACTCAGTGGTGGAGCAGGG - Intronic
1143152693 17:4817079-4817101 CTGGAGGTAGGGAGGGAGCCAGG + Intronic
1144304804 17:13958885-13958907 GTGGAGGGAGTGACAGAGCACGG + Intergenic
1144390865 17:14792183-14792205 CTGGAGGAGGTGATGCTTCAAGG - Intergenic
1144701937 17:17346089-17346111 CTGGACGCAGTGATGGAGGTGGG - Intronic
1144792674 17:17869799-17869821 CTGTACCAAGTGATGGAGAACGG - Intronic
1144958986 17:19034307-19034329 CGGGAGGAAGGGATGAAGGAAGG - Intronic
1144976173 17:19140217-19140239 CGGGAGGAAGGGATGAAGGAAGG + Intronic
1145268294 17:21391085-21391107 CTGGAGGACATGATGGAGATGGG - Intronic
1145786505 17:27597310-27597332 GTGGAGGAGGTGGTGGAGGAAGG - Exonic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1145990813 17:29078408-29078430 ATGGGGGAAGTGACAGAGCAGGG + Exonic
1146290544 17:31603476-31603498 CTGGAGGATGAGAAGGGGCAGGG - Intergenic
1146436256 17:32851344-32851366 CTTGAGGAAGTGAGAGAGGATGG - Intronic
1146645491 17:34574433-34574455 CTGAATGAAGTAAAGGAGCAAGG + Exonic
1146827959 17:36040452-36040474 AGGGAGGAAGTGAGGAAGCAAGG + Intergenic
1146923536 17:36729239-36729261 CTGGAGGAAGGGAGGGAGGGAGG - Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147032294 17:37649131-37649153 GTGTAGGAAGTGAGGGAGTAAGG + Intergenic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147910008 17:43849711-43849733 CAGCAGGAAGTGATGGAACTGGG + Intronic
1148287744 17:46410703-46410725 CTGGAGCAAAGGCTGGAGCATGG - Intergenic
1148309913 17:46628283-46628305 CTGGAGCAAAGGCTGGAGCATGG - Intronic
1148465578 17:47863135-47863157 AAGGAGGATGGGATGGAGCATGG + Intergenic
1148757956 17:49984433-49984455 CTGGAGGATTAGCTGGAGCAGGG - Intergenic
1149426445 17:56559036-56559058 AAGGAGGAAGTGATAGAGAAGGG + Intergenic
1150454349 17:65294707-65294729 CTGGAGGAAGGGCTGGGGCTGGG + Intergenic
1150556905 17:66262703-66262725 CTGGGGGCAGGGATGGAGAAGGG + Intergenic
1150766827 17:68009002-68009024 CTGGAAGAAGTGGTGGAAGAAGG - Intergenic
1151604010 17:75124916-75124938 CTGGTGGAAGGGACAGAGCAAGG + Intronic
1151996580 17:77613150-77613172 CTCCAGGAGGTGATGGAGAAGGG + Intergenic
1152002224 17:77654084-77654106 TCGGAGGAAGTGGTGGATCAGGG - Intergenic
1153486091 18:5599646-5599668 CAGGAGCAAGAGATAGAGCAAGG - Intronic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156967582 18:43114015-43114037 AAGGAGGAAGGGATGGAGGAAGG - Intronic
1157024603 18:43828146-43828168 AGGGATGAAGAGATGGAGCACGG - Intergenic
1157274238 18:46298846-46298868 CTGGAGAGAGTCATGGAGCGGGG + Intergenic
1157743081 18:50110364-50110386 CTGGAGCAAATGAGGGAGGAAGG - Intronic
1158461096 18:57646273-57646295 AGGGAAGAAGTGATGGAGAAAGG - Intergenic
1159652051 18:70988890-70988912 ATTGAGCAAGTGAAGGAGCATGG - Intergenic
1159898604 18:74021053-74021075 CAGGAGGAAGAGAGAGAGCAAGG + Intergenic
1160334712 18:78028519-78028541 CTAGAGGAATTGTTGGATCAAGG - Intergenic
1160622089 18:80178818-80178840 TGGGAGGAAGTGATGGGGCAGGG - Intronic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161329013 19:3677745-3677767 ATGGAGGGAGGGATGGAGGATGG + Intronic
1161329329 19:3678784-3678806 ATGGAGGGAGGGATGGAGAATGG + Intronic
1161329376 19:3678930-3678952 GTGGAGGGAGGGATGGAGAATGG + Intronic
1161443206 19:4304201-4304223 CTGGAGGAGCTGTTGGAGCCTGG + Intergenic
1162138505 19:8571037-8571059 CAGGAGGAAGGGCTGGAGGAGGG + Intronic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1163273289 19:16266971-16266993 CTGGAGGAAGGGATGCTGGAAGG + Intergenic
1164551529 19:29216552-29216574 CAGGTGGAGGTGATGGATCATGG - Intergenic
1165051150 19:33142377-33142399 CTGGAGAAAGTGGTGGAGGGAGG + Intronic
1165118723 19:33545447-33545469 GGGGAGGAAGTGATTGGGCAGGG + Intergenic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165410389 19:35656916-35656938 AGCTAGGAAGTGATGGAGCAGGG + Intronic
1165435444 19:35792483-35792505 CTGGTGGGAGTGAGGGATCAGGG - Intergenic
1166146309 19:40838741-40838763 AAGGAGGAAGAGATGGAGAAAGG - Intronic
1166348647 19:42182888-42182910 CTGGAGCAGGCAATGGAGCAGGG + Intronic
1166541883 19:43611102-43611124 CAGGAGGAGGTGCTGGGGCAGGG - Intronic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1167050103 19:47072646-47072668 GTGGAGGAACTGAAGAAGCAGGG - Exonic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167538980 19:50073471-50073493 CTGGAGGAAGAGAAGCAGGACGG + Intergenic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1167633052 19:50637757-50637779 AAGGAGGAAGAGATGGAGAAGGG + Exonic
1168616358 19:57840121-57840143 CTGGAGGAGGTCATGGAGTCAGG + Intronic
1168620503 19:57875913-57875935 CTGGAGGAGGTCATGGAGTCAGG - Intronic
1168624299 19:57904672-57904694 ATTTAGGAAGTGATGGAGCTTGG - Intronic
1202636193 1_KI270706v1_random:46750-46772 CTGGAGGTAGTGTTGGTTCAGGG + Intergenic
925299435 2:2800149-2800171 AAGGAGGAAGGGATGGAGGAAGG + Intergenic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
925654869 2:6135753-6135775 TGGGAGGAAGGGTTGGAGCAGGG + Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925925705 2:8668504-8668526 CTGGATGGAGTGATGGATGAAGG + Intergenic
926504880 2:13701308-13701330 CCGGAGGAGGTGCAGGAGCACGG + Intergenic
926591510 2:14744824-14744846 ATGGAGGAAGGGATGCAGAATGG + Intergenic
926796276 2:16621691-16621713 CTGGAGAAAGTGAGGGAGCAAGG - Intronic
926849845 2:17183725-17183747 ATGGAGGAAGTGATGGAAATGGG + Intergenic
927552930 2:24014778-24014800 CCGGAGGGAATGATGGAGAATGG + Intronic
928601550 2:32908659-32908681 CTGTAGCAAGTTATGGAGAAGGG - Intergenic
928952626 2:36826510-36826532 CTAGAGGAAAAGAAGGAGCAGGG - Intergenic
929239585 2:39640062-39640084 GTGCAGGCAGGGATGGAGCAGGG + Intergenic
929373521 2:41256002-41256024 CAGGAGGAAGGGAGGGAGTAGGG + Intergenic
929892622 2:45930981-45931003 CAGGAGGAAATGAAGGATCAGGG - Intronic
930019710 2:46994182-46994204 TTGGAGGGACTGAAGGAGCAAGG + Intronic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
931867064 2:66425022-66425044 ATGGAGTCAGGGATGGAGCAGGG + Intergenic
932211596 2:69936021-69936043 CTGGAAGAAGGGCTGGAGAAAGG - Intronic
932812806 2:74838302-74838324 CTGCAGGAAGTGGAGGAGCTGGG + Intronic
933537722 2:83597396-83597418 CTGGAGCAAGCCAAGGAGCATGG - Intergenic
934765106 2:96876190-96876212 CTGGAGGAAGCGAAGCATCAAGG - Exonic
934979219 2:98826484-98826506 CTGAAGGAAGTGAACGGGCAGGG + Intronic
935654826 2:105413100-105413122 CTGGTGGAAGGGATGGAACCAGG - Intronic
936018788 2:108979365-108979387 CTGGGGGAAGTGGTGGGGCAGGG - Intronic
936432935 2:112480744-112480766 CAGGAGGAATTGATGCAGCATGG + Intergenic
936523422 2:113226848-113226870 CTGGAAGAAGTGGTGGAGCTTGG + Intronic
936856022 2:116958163-116958185 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
938462809 2:131509039-131509061 CTGGAGGAGGTGGGGGAGTAGGG - Intergenic
939023366 2:136984438-136984460 CAGGAGCAAGAGAAGGAGCAAGG - Intronic
940554587 2:155207370-155207392 CTATAAGAAGTGATGGAGCCGGG + Intergenic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
941152870 2:161937379-161937401 GTGGAGGAAGAGATGGGGTATGG - Intronic
941756319 2:169190435-169190457 AAGGAGGAGGTGAAGGAGCAGGG - Intronic
942764881 2:179443318-179443340 CTGGAGGAATGGCTGGAGCCTGG + Exonic
945613928 2:212043740-212043762 ATGTAGTAAGTGTTGGAGCAGGG - Intronic
947094984 2:226556064-226556086 GTGGAGTAATTGATGGAACAAGG + Intergenic
947637384 2:231686926-231686948 CTGTGGGATGTGATGGAGCCAGG - Intergenic
947709936 2:232307287-232307309 CTTTAGGAAGGGAGGGAGCATGG + Intronic
947750629 2:232530205-232530227 CAGGAGGAAGTGAGGGGGCAGGG - Intronic
948228904 2:236335322-236335344 CTGGAGGAAATGCTGGATGAGGG + Intronic
948396535 2:237649102-237649124 CTGGAGGAGGTGCTGGGCCATGG + Intronic
1168819869 20:765577-765599 GGGCCGGAAGTGATGGAGCAGGG + Exonic
1169117020 20:3072340-3072362 CTGGAGGAAGAGGTGGAGTCAGG - Intronic
1169554607 20:6736044-6736066 ATAGAGAAAGTGTTGGAGCATGG - Intergenic
1169740564 20:8889182-8889204 GTGGTGGAAGTGATGGTGCATGG - Intronic
1170165249 20:13355388-13355410 CTGGAGGTAGTGTTGCAGAAAGG - Intergenic
1170381530 20:15765038-15765060 CTAGAAGAAGTGAGAGAGCAAGG - Intronic
1170690974 20:18614814-18614836 CAGGAGGAAGGGAAGGAGGAAGG - Intronic
1170762473 20:19263007-19263029 CTGGAGTGGGTGATGGAGCGAGG - Intronic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1172095401 20:32457734-32457756 ATGGAGGGAGTGGTGGAGCTAGG - Intronic
1172148543 20:32774653-32774675 CGGGAGGATGGGAAGGAGCAAGG - Intronic
1172225521 20:33302798-33302820 CTGGAACACGTGAGGGAGCAGGG + Intronic
1172893842 20:38285683-38285705 CAGGAGGAAGAGAAAGAGCAGGG - Intronic
1173120182 20:40282044-40282066 CTTGAAGGAGTGAAGGAGCAAGG + Intergenic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173262995 20:41453037-41453059 CTGGAGGATGAGACGGGGCATGG - Intronic
1174112124 20:48204432-48204454 CTGGAGGAGGTGGGGGAGCCCGG + Intergenic
1175239779 20:57538547-57538569 CAGAAGGAAGTGAGGGAGCAGGG + Intergenic
1175541041 20:59747814-59747836 CTGCTGGAGATGATGGAGCAGGG + Exonic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176087251 20:63303800-63303822 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
1176143992 20:63557457-63557479 GTGGAGGGAGGGGTGGAGCATGG - Intergenic
1176154778 20:63613408-63613430 CTGGTGGCAGTGACGGACCAGGG - Intronic
1179336693 21:40463450-40463472 CTGGAAGAACTGATGGAAGAAGG - Intronic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179991282 21:44949393-44949415 CTGGAGGAGGCTATGGTGCAGGG - Intronic
1180017611 21:45097562-45097584 CAGGCAGGAGTGATGGAGCATGG + Intronic
1181404387 22:22672425-22672447 GAGGAGGAGGAGATGGAGCAGGG + Intergenic
1181978248 22:26747781-26747803 CTGGAGGAAGTGAAGGGAGAGGG + Intergenic
1181999251 22:26906789-26906811 ATGGAAGAAGGGATGGAGAAAGG + Intergenic
1182444212 22:30380775-30380797 CAGGAGGAAGTGCAGGAGGATGG - Intronic
1182520703 22:30883101-30883123 TGGCAGGAAGTGATGGTGCAGGG + Intronic
1182855727 22:33516169-33516191 CTGCAGGAAATGAAGGAGCGAGG + Intronic
1183022544 22:35038956-35038978 CTGGAGGAAGAGGTGCAGCCAGG - Intergenic
1183216314 22:36482215-36482237 GAAGAGGAGGTGATGGAGCAGGG + Intergenic
1183301627 22:37061648-37061670 CTGGAGGGAGGGGTGGAGCGAGG + Intronic
1183478385 22:38049522-38049544 ATGGAGGAAGGGGTGCAGCATGG + Intergenic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183713179 22:39518782-39518804 CAGGAGGATGTGATGGAGAGTGG + Intergenic
1184320505 22:43739054-43739076 CTGGAGGAAGAGGTGAGGCAAGG - Intronic
1184516537 22:44965907-44965929 AGAGAGGAAGTGGTGGAGCAGGG - Intronic
1184969468 22:48004906-48004928 CTGGTGGGAGTGAAGGAGCCCGG + Intergenic
1185143569 22:49117230-49117252 CTGGAGCAGGTGTTGGGGCAGGG + Intergenic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949545792 3:5071090-5071112 CGGCAGGAAGGGATGGAGCCCGG - Intergenic
949732677 3:7131881-7131903 CTGGAGAAAATGATGTGGCAAGG - Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
951518496 3:23588709-23588731 GTGGAGAAAGGGGTGGAGCAGGG - Intronic
952513050 3:34076332-34076354 CTGAAGGAAGTGAGGGAGTCAGG + Intergenic
952871832 3:37907533-37907555 GTGGAGGAGGTGAAGGAGAAAGG + Intronic
953695453 3:45154877-45154899 TTTGAGGAGGTGATGGTGCATGG - Intergenic
954196387 3:48999517-48999539 CAGAAGGCAGTGATGGAGCAGGG - Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954456117 3:50600743-50600765 CTGGTGGAAGTTCTGGACCAAGG - Intergenic
954641077 3:52098250-52098272 CTGGAGGAAGGGTGTGAGCAGGG + Intronic
955398276 3:58573017-58573039 CTGGAGCAAGTCATTGAGCCAGG - Intronic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
956874056 3:73444682-73444704 GTGGAGGTAGTGGTGGAGTAAGG + Intronic
958693399 3:97497383-97497405 TTGGAGGAAGTGAGGGAGTGGGG - Intronic
959017113 3:101147411-101147433 TTGTAGGAAGTGATCGAGTATGG - Intergenic
959137103 3:102436937-102436959 GAGAAGGAAGTGGTGGAGCATGG + Intronic
960315749 3:116174609-116174631 CTGGTTGAAGTGAAGGAGAAGGG - Intronic
960459651 3:117917855-117917877 AGTGAGGAAGTGAGGGAGCAGGG - Intergenic
960544046 3:118891646-118891668 CAGTAGGAAGTGACGGAGCTGGG + Intergenic
960633339 3:119755509-119755531 ATGGAGGAAGAGAGGGAGAAAGG - Intronic
961136949 3:124520176-124520198 CAGGAGGGAATGAGGGAGCAGGG + Intronic
961236826 3:125374907-125374929 CTGGGGGACGTGAGGAAGCAGGG - Intronic
962130117 3:132663498-132663520 CTGTTGGAAGTGAAGAAGCAAGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
962932194 3:140048912-140048934 ATGGAGGTAGTGAAGCAGCAGGG - Intronic
964028116 3:152102968-152102990 TTGGAGGAAGGGAGGGAGGAAGG - Intergenic
965211649 3:165797324-165797346 CTGGAGGGAGGGAGGGAGGAAGG - Intronic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967138245 3:186530596-186530618 CAGCAGGAAGTGAGGGGGCAGGG + Intergenic
967417843 3:189238928-189238950 CTTGAAGAAGTGGTGCAGCAGGG + Intronic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
969129202 4:4978968-4978990 ATAAATGAAGTGATGGAGCAAGG - Intergenic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969522944 4:7689341-7689363 TTGGAGGAACGGATGGAGGATGG - Intronic
969600185 4:8171503-8171525 CTTGAGGCAGGGAAGGAGCAGGG + Intergenic
969984301 4:11191147-11191169 CAGGAGGAAGAGAGAGAGCAGGG + Intergenic
970224556 4:13844119-13844141 ATGGAGGAAGGGAGGGAGAAAGG - Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970434632 4:16021815-16021837 CTGGGGGAAGTGGTGGAGTTGGG - Intronic
970570655 4:17378440-17378462 CAGTAGGAAGTGGAGGAGCAGGG + Intergenic
970994070 4:22245804-22245826 CTGGAGGAAGGAATGCTGCATGG + Intergenic
971351516 4:25860348-25860370 CTGGAGGAAGTGGTTGGTCAGGG - Intronic
973366002 4:49210136-49210158 CTGGAGGTAGTGTTGGTTCAGGG + Intergenic
973394596 4:49582315-49582337 CTGGAGGTAGTGTTGGTTCAGGG - Intergenic
973916195 4:55636654-55636676 CTGGAAGAGGTGAAGGAGAAAGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976657907 4:87508514-87508536 CTGGAGGAAGGAATGTTGCATGG - Intronic
977249969 4:94678841-94678863 CTGGAGGAAGCAAGAGAGCAAGG + Intergenic
977609874 4:99020613-99020635 CTGAAGCAAGGGATGGAGGAGGG - Intronic
977760655 4:100732717-100732739 CTGGAGGAAGTGAGGGCAAAGGG + Intronic
978792570 4:112678046-112678068 CTAAATGAAGTGATGGAGCAAGG - Intergenic
979787283 4:124732395-124732417 GTAGAGGAAGTGGTGGTGCAGGG - Intergenic
981745566 4:148049329-148049351 CTGGAGGCAGGCAAGGAGCAGGG - Intronic
981884965 4:149663920-149663942 CTGGGGGAAGAAATGGAGAAGGG - Intergenic
982291166 4:153784270-153784292 CTTAATGAAGTGATGTAGCATGG + Intronic
982744108 4:159088438-159088460 CTGGGGGAAGGAAAGGAGCAGGG + Intergenic
983054874 4:163090131-163090153 GAGGCGGAAGGGATGGAGCAGGG - Intergenic
983795653 4:171859440-171859462 CTTCAGGAAGGGAGGGAGCATGG + Intronic
984632226 4:182073292-182073314 CAGTGGGAAGTGATGGATCACGG - Intergenic
984953369 4:185022443-185022465 TTCTATGAAGTGATGGAGCATGG + Intergenic
1202763507 4_GL000008v2_random:132617-132639 CTGGAGGTAGTGTTGGTTCAGGG + Intergenic
985504491 5:271385-271407 GGACAGGAAGTGATGGAGCACGG - Intergenic
985629663 5:1008088-1008110 CAGGAGGAAGTGAGGGAAGAAGG + Intergenic
985766816 5:1784444-1784466 CTGGAGGAAGACTGGGAGCACGG - Intergenic
986360854 5:6976417-6976439 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
986438541 5:7758790-7758812 CTGGAGGAAGTGAGGGGCAAGGG + Intronic
986583230 5:9287107-9287129 CTGGAGGAAGTGCAGGTGGACGG - Intronic
987456281 5:18151043-18151065 CTGGAGCAACTTATGGAGCTGGG - Intergenic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
988780517 5:34516934-34516956 CTGAAGGAAATGAGGCAGCAAGG - Intergenic
989270471 5:39527084-39527106 CTGAAGGAAGTGGCGGAGAAAGG + Intergenic
990240673 5:53813376-53813398 CTGGAGGAAGTGAGGTGGCTAGG - Intergenic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
991391131 5:66144533-66144555 CCGGAGTAAGTGCTGGAGCTCGG + Exonic
992162881 5:74019650-74019672 TTGGAGGAAGTGATGAGGAATGG + Intergenic
994691693 5:103027442-103027464 CTTGAGGGAGTGATGAAGCCTGG + Intronic
994993451 5:107028899-107028921 CAGGAGGGAGAGGTGGAGCAGGG - Intergenic
996373140 5:122774726-122774748 CTGTAGGAAGTGGTAGAGCCTGG - Intergenic
997021417 5:130007395-130007417 CTGAAGGAAGTAATAGAGAATGG + Intronic
997729457 5:136156595-136156617 CTGAAGGAACTGATGAAGAAAGG + Intronic
998815053 5:146005554-146005576 TTGAAGGAAGGGATGGAGGAAGG + Intronic
998886654 5:146701550-146701572 CTGGGGGCTGTGATGAAGCAGGG + Intronic
999665598 5:153909952-153909974 CTGGAAGAATTGATGGCTCATGG + Intergenic
999690820 5:154144525-154144547 CTGGAGGAGGCCATGGTGCATGG - Intronic
1000239119 5:159392872-159392894 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1000277016 5:159746906-159746928 TTGGGGCAAGTGAGGGAGCAAGG + Intergenic
1000661888 5:163948344-163948366 CTGGAGGCAGGGATCGGGCAGGG + Intergenic
1001019946 5:168174314-168174336 CTTGAGGAAGTGGAGGAGCTGGG - Intronic
1002170154 5:177370462-177370484 CTAGAGGAAGGGATGGAGGGTGG - Intronic
1002701597 5:181128652-181128674 GAGGAGGAGGTGAGGGAGCAAGG - Intergenic
1002934982 6:1663750-1663772 ATGAAGGAAATGAGGGAGCAGGG - Intronic
1003570660 6:7254308-7254330 CTGGAGGAGGGCATGGGGCATGG + Intergenic
1003967408 6:11266244-11266266 CTGGAGTAAGTGAGGGGGGAGGG - Intronic
1003977835 6:11360584-11360606 CAGGAGGAAGAGAGAGAGCAGGG - Intronic
1006153656 6:32002488-32002510 CTGGAGGAAGTCGTTGAGCTGGG - Exonic
1006159964 6:32035225-32035247 CTGGAGGAAGTCGTTGAGCTGGG - Exonic
1006269084 6:32950114-32950136 CTGAAGGAAGTCATGGTGGAGGG - Intronic
1006449919 6:34099844-34099866 CTGGAGGAGGCGCTGGGGCAAGG - Intronic
1006793353 6:36717546-36717568 CTGGAGGAAGAGGTGGCTCAGGG + Intronic
1006900686 6:37499089-37499111 ATGGTGGAAGTGGTGGAGCCTGG - Intronic
1007445491 6:41902331-41902353 CAGGAGGCAGTGTGGGAGCAGGG + Intergenic
1007717291 6:43864662-43864684 CTGGAGGCAGTGACCCAGCAAGG - Intergenic
1007947541 6:45839717-45839739 CTGCAGGAGGTGATGGAGCAGGG - Intergenic
1008096797 6:47347181-47347203 CTGGAGGAGGTGATGGTGCTGGG + Intergenic
1008511075 6:52276356-52276378 ATCCATGAAGTGATGGAGCAGGG - Exonic
1008665090 6:53708239-53708261 CAGCAGGAAGTCATGGAACATGG - Intergenic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1014003677 6:116392932-116392954 CTGATGGCAGTGATGGAGCCAGG + Intronic
1014444164 6:121506908-121506930 CTCTAGAAAGTGATGCAGCAAGG + Intergenic
1015318818 6:131848085-131848107 CTGGAGGAAGTCAGGGAGCATGG - Intronic
1016001622 6:139047587-139047609 GTGGGGCAAGTGATTGAGCAGGG + Intergenic
1016501153 6:144722297-144722319 CGGAGGGAAGTGAGGGAGCAAGG - Intronic
1017466521 6:154699018-154699040 TTGGAGGAAGTGTTTCAGCAAGG + Intergenic
1018347745 6:162920188-162920210 AAGGAGGAAGTGAGGGAGGAAGG + Intronic
1018699585 6:166416084-166416106 ATGGTGGAGGTGATGGAGGAAGG - Intronic
1019191508 6:170253672-170253694 ATGGAGGAAGCCACGGAGCAAGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019897438 7:3993682-3993704 CTGGAGGAAGGGCTGGAGGAGGG - Intronic
1020191913 7:6006890-6006912 GTGGAGGATGTATTGGAGCAGGG - Intronic
1021970362 7:25959730-25959752 CTAGAGGAAGTAAAGGAGCTGGG + Intergenic
1022100719 7:27167409-27167431 CTAGAGGAATTTATGGGGCAAGG - Intronic
1023188097 7:37551940-37551962 GTGGAGGAAGTGACAGGGCAAGG + Intergenic
1023284890 7:38608697-38608719 CTGCAAGAAGTGATGGTGGAAGG + Intronic
1024085534 7:45889017-45889039 CGGCAGGAGGTGCTGGAGCAGGG - Intronic
1026212730 7:68321204-68321226 CTGGAGGTGGTGAGGGAGAATGG - Intergenic
1026354049 7:69541937-69541959 TAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1026539819 7:71269817-71269839 CTGGGGGAGGTGATGGAAGACGG + Intronic
1026611658 7:71865306-71865328 CTGGAGGAAGAGATAGAGAGGGG - Intronic
1026745496 7:73008247-73008269 GTGGAGGATGGGTTGGAGCAGGG + Intergenic
1026749147 7:73036187-73036209 GTGGAGGATGGGTTGGAGCAGGG + Intergenic
1026752795 7:73064332-73064354 GTGGAGGATGGGTTGGAGCAGGG + Intergenic
1026756446 7:73092458-73092480 GTGGAGGATGGGTTGGAGCAGGG + Intergenic
1027031607 7:74892921-74892943 GTGGAGGATGGGTTGGAGCAGGG + Intergenic
1027090959 7:75300964-75300986 GTGGAGGATGGGTTGGAGCAGGG - Intergenic
1027094604 7:75328936-75328958 GTGGAGGATGGGTTGGAGCAGGG - Intergenic
1027098245 7:75356863-75356885 GTGGAGGATGGGTTGGAGCAGGG - Intergenic
1027324737 7:77038744-77038766 GTGGAGGATGGGTTGGAGCAGGG + Intergenic
1027446605 7:78280671-78280693 CAGGAGTAAGTGGTGGAGCCAGG + Intronic
1027581746 7:80005425-80005447 CAGGAGGAAGAGAGAGAGCAGGG - Intergenic
1029399357 7:100333763-100333785 GTGGAGGATGGGTTGGAGCAGGG - Intergenic
1029647697 7:101868748-101868770 CTGTAGGGAGTGATGGAGAGAGG + Intronic
1030099879 7:105936418-105936440 ATGGTGGAAGGGATGGAGGATGG - Intronic
1030343848 7:108410766-108410788 GTGGAGGAAGTGGTCCAGCATGG + Intronic
1030568367 7:111189065-111189087 CTGGAGTAAGTGGTAGAGAATGG + Intronic
1030987029 7:116253798-116253820 CTGGAGGAAATGGTGGAGTTTGG - Intronic
1031371024 7:120966669-120966691 CTGGAGTATGTGAATGAGCATGG - Exonic
1031488114 7:122354362-122354384 ATAGATGAAGTGATGGAGCAAGG + Intronic
1031733314 7:125324956-125324978 CTTAAGTAAGTGATGGAGCCAGG + Intergenic
1032663509 7:134012040-134012062 ATGGATGAAGTGAGTGAGCAGGG + Intronic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1035435561 7:158856724-158856746 CTGCGGGAAGCGATGGAGCCCGG + Exonic
1035579207 8:729374-729396 CAGGAGGAGGGGATGGAGCTTGG - Intronic
1035670317 8:1412074-1412096 CTGGAGGCAGGAATGGAGAAAGG - Intergenic
1035673986 8:1442161-1442183 CTGGAGGAGGAGATGGATCCAGG + Intergenic
1035705133 8:1669456-1669478 CTGGCGGACGTGGTTGAGCAGGG + Intronic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1036563095 8:9914070-9914092 CTGGAGAACGGCATGGAGCATGG - Intergenic
1037881024 8:22573581-22573603 CTGGAGGAAATGAGGGAGCTGGG + Intronic
1037950207 8:23014615-23014637 CTGGGGGATGTGGTGGGGCAGGG + Intronic
1038402681 8:27297395-27297417 CTGGAGGAAGAGAGGGTGCCAGG + Intronic
1038497384 8:28013249-28013271 GAGGAGGAAGAGAGGGAGCAAGG + Intergenic
1038662560 8:29509816-29509838 CAGGAGGAAGAGAGGGAGCAGGG + Intergenic
1041185372 8:55294652-55294674 CTGGAGACAGTGAGGGAGTAAGG - Intronic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041847653 8:62349836-62349858 CAGGAGGAAGAGATGAAACAAGG - Intronic
1042110407 8:65375731-65375753 CTGGAGGAAGAGATGCAGCCAGG - Intergenic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1045411977 8:101929246-101929268 GAGGAGGAAGGGATGGAGGAAGG + Intronic
1045411982 8:101929258-101929280 ATGGAGGAAGGGATGGAGGGAGG + Intronic
1045771334 8:105743547-105743569 CTGGTGGGGGTGTTGGAGCATGG + Intronic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048416159 8:134229888-134229910 GTGGAGGGAGATATGGAGCAAGG - Intergenic
1048467993 8:134683540-134683562 CTGGAGGAAGGAAAGGAGAAGGG + Intronic
1048573890 8:135676237-135676259 CTGGAGGAAGCCATGGAGATAGG - Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1049120558 8:140733215-140733237 CTGGAGGAAGTGAGGAGGAAGGG + Intronic
1049203624 8:141353334-141353356 CTGGCGGAGGGTATGGAGCAGGG - Intergenic
1049214685 8:141402276-141402298 CTGGAGGAGGTGGTGGAGAGAGG - Intronic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049502906 8:142977265-142977287 CATGAGGAAGTGATGGAGATTGG + Intergenic
1049535690 8:143180279-143180301 CTGGTGGTGGTGATGGGGCAGGG - Intergenic
1050029588 9:1371611-1371633 CTGGAGGAAGTTGTGGAGTCTGG + Intergenic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1052304679 9:26993783-26993805 CTAGAGGTATGGATGGAGCAAGG - Exonic
1053682302 9:40493696-40493718 CTGGAGTAAGGAATAGAGCAAGG + Intergenic
1054281412 9:63131233-63131255 CTGGAGTAAGGAATAGAGCAAGG - Intergenic
1054393418 9:64633700-64633722 CTGGAGTAAGGAATAGAGCAAGG + Intergenic
1054428068 9:65138914-65138936 CTGGAGTAAGGAATAGAGCAAGG + Intergenic
1054502311 9:65882630-65882652 CTGGAGTAAGGAATAGAGCAAGG - Intronic
1054759713 9:68993366-68993388 CTGAAGGAAGTGAGGGAGCATGG - Intronic
1055175141 9:73309383-73309405 CTTGAGGAAGTGATGACTCAAGG - Intergenic
1055305875 9:74928475-74928497 CTGGAGGAAGGAATGCTGCACGG - Intergenic
1055523449 9:77106033-77106055 CTGGAAGAAGTGAAGGAAGAGGG + Intergenic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056719171 9:89058573-89058595 GTGGAGGATGTGGTGGAGGATGG + Intronic
1056719290 9:89059110-89059132 GTGGAGGATGTGGTGGAGGACGG + Intronic
1056719297 9:89059135-89059157 GTGGAGGATGTGGTGGAGGATGG + Intronic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1056719421 9:89059658-89059680 GTGGAGGACGTGGTGGAGGATGG + Intronic
1056719442 9:89059734-89059756 GTGGAGGACGTGGTGGAGGATGG + Intronic
1056719550 9:89060210-89060232 GTGGAGGATGTGGTGGAGGACGG + Intronic
1057642908 9:96844574-96844596 GTGGAGGAAGGGATGGAGGGAGG + Intronic
1058390699 9:104492010-104492032 AGGGAGGGAGAGATGGAGCAAGG + Intergenic
1059237319 9:112771970-112771992 CTGGTTCAAGTCATGGAGCAGGG + Intronic
1059642358 9:116229751-116229773 CTAGAGGAAGGGAAGCAGCAAGG + Intronic
1059675823 9:116538185-116538207 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1059762759 9:117354688-117354710 CTGGAGGGAGGGAAGGAGGAGGG - Intronic
1059903471 9:118954766-118954788 TGGGGGGAAGTGATGGAGGATGG + Intergenic
1060085105 9:120691718-120691740 AGGGAGTAAGTGATGGAGCTGGG + Intronic
1060329983 9:122659378-122659400 CAGGTGGAAGTGATGGGGGAGGG - Intergenic
1061045144 9:128160744-128160766 CTGAAGGAAGTGGTGGAGCAAGG - Intronic
1062130746 9:134891808-134891830 CAGGAGGAACTGACCGAGCATGG + Intergenic
1062437132 9:136551318-136551340 CTGGGGGTAGTGAGGGGGCATGG - Intergenic
1203544262 Un_KI270743v1:117490-117512 CTGGAGGTAGTGTTGGTTCAGGG + Intergenic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1187122289 X:16421145-16421167 CTGGAGCAAGAGAGAGAGCAAGG + Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1188191062 X:27172410-27172432 CAGGAGGAAGTGAGAGAGTAGGG + Intergenic
1188506908 X:30892733-30892755 CTGGAGGAAGTGTTTGAGTGAGG + Intronic
1188775678 X:34215629-34215651 CAGGAGCAAGTGATAGAGCAAGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189198368 X:39170471-39170493 ATCTAGGAAGTGATGGAGCCAGG + Intergenic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1189962925 X:46341564-46341586 GCGGGGGAAGTGATGGGGCAGGG + Intergenic
1190306872 X:49088573-49088595 CTGGAAGAAGTAATGGTTCAAGG + Intronic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1190739564 X:53280260-53280282 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1191695498 X:63985770-63985792 CTGGTGGCAGTGTTGGTGCAAGG - Intergenic
1191930535 X:66366731-66366753 CTGGAGGCAGTGAGGCAGTATGG - Intergenic
1191979328 X:66908683-66908705 ATGCAGTAAGTGGTGGAGCAGGG - Intergenic
1192001510 X:67156824-67156846 CTCTAGGAAGTGATGGAGCTAGG - Intergenic
1192271843 X:69588224-69588246 CTGCAGGAAGTCATGAAGGAAGG - Intergenic
1192364050 X:70455970-70455992 CTTGAGGCACTGAAGGAGCATGG - Intronic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1194336995 X:92660259-92660281 CTGGAGGAAGAAATGCTGCAAGG + Intergenic
1195603411 X:106774182-106774204 TTGGAGGAGGTGTTGGAGAAAGG - Intronic
1195803008 X:108734404-108734426 CTGGAGGAACTGGTGGAAAAGGG - Exonic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1196007646 X:110852913-110852935 CTGTAGGAGGTGGGGGAGCAGGG - Intergenic
1196131966 X:112166521-112166543 CTAGAGGAAGTGAGAAAGCAGGG + Intergenic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1197268856 X:124404445-124404467 CTGGAGGAAGTTATAGATTAGGG - Intronic
1197834185 X:130677203-130677225 GAGGAGGAAGTGAGGGAGGAAGG - Intronic
1198804793 X:140483618-140483640 CAGGAGTTAGTGGTGGAGCATGG - Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic
1201065895 Y:10093297-10093319 CTGGAGGAAGAACTGGAGCGTGG - Intergenic
1201474385 Y:14364718-14364740 AAGGAGGAAGAGAAGGAGCATGG + Intergenic
1202368660 Y:24183139-24183161 CTGGAGTAAGGGGTGGAGCTGGG - Intergenic
1202502125 Y:25486978-25487000 CTGGAGTAAGGGGTGGAGCTGGG + Intergenic
1202578057 Y:26348459-26348481 CTGGAGCAAGTAAAGAAGCAAGG - Intergenic