ID: 902711456

View in Genome Browser
Species Human (GRCh38)
Location 1:18242868-18242890
Sequence TGGCTCACACTCTGCTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902711442_902711456 28 Left 902711442 1:18242817-18242839 CCTGCAGAAAACCTTGGCAGGGC 0: 1
1: 0
2: 1
3: 17
4: 172
Right 902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG 0: 1
1: 0
2: 2
3: 23
4: 272
902711447_902711456 -6 Left 902711447 1:18242851-18242873 CCTAGAGATGCCATCCCTGGCTC 0: 1
1: 0
2: 3
3: 40
4: 289
Right 902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG 0: 1
1: 0
2: 2
3: 23
4: 272
902711444_902711456 17 Left 902711444 1:18242828-18242850 CCTTGGCAGGGCCTTGGCTGCAG 0: 1
1: 0
2: 0
3: 53
4: 688
Right 902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG 0: 1
1: 0
2: 2
3: 23
4: 272
902711445_902711456 6 Left 902711445 1:18242839-18242861 CCTTGGCTGCAGCCTAGAGATGC 0: 1
1: 0
2: 0
3: 20
4: 257
Right 902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG 0: 1
1: 0
2: 2
3: 23
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902711456 Original CRISPR TGGCTCACACTCTGCTGGGG GGG Intronic
900520018 1:3100946-3100968 TGGCTGACATTCTGCCCGGGAGG + Intronic
900541665 1:3206014-3206036 TCGCTCACACACAGCTGGGAGGG - Intronic
901263006 1:7887311-7887333 CTGCTCACACCCTGCTGTGGAGG - Intergenic
901627253 1:10631302-10631324 TGCCCCTCCCTCTGCTGGGGAGG + Intergenic
901763683 1:11486931-11486953 GGCCTCCCACTGTGCTGGGGTGG + Intronic
902711456 1:18242868-18242890 TGGCTCACACTCTGCTGGGGGGG + Intronic
904383730 1:30128297-30128319 TGGCTCAGATTCTGCAGTGGGGG + Intergenic
904447717 1:30588424-30588446 GGGCTCACAGTCTGATGGAGAGG - Intergenic
905957135 1:42007171-42007193 AGGCTCTCTCTCTGCTGTGGTGG - Intronic
906209204 1:44002821-44002843 GGGCACAGACCCTGCTGGGGAGG + Intronic
906581731 1:46940727-46940749 AGGAGCTCACTCTGCTGGGGTGG - Intronic
906836839 1:49092686-49092708 TTGCTCACAGTCTGCTGAGAAGG - Intronic
907314249 1:53558475-53558497 TGGCTGGAAGTCTGCTGGGGTGG - Intronic
907843187 1:58176503-58176525 TGGCTCACAGTCTGCAGGCTGGG + Intronic
908879209 1:68711715-68711737 TGGTTCAGTCTCTGCGGGGGAGG - Intergenic
912310669 1:108617833-108617855 TGTGTCACACGCTGCTGGAGTGG + Intronic
916263754 1:162869208-162869230 GAGCTCAGACTCTGCTTGGGTGG - Intergenic
916677846 1:167078971-167078993 TGTCTCATACTCTGTTGTGGAGG + Intronic
917597047 1:176539532-176539554 TGGCTCACAGTCTGGGGTGGAGG + Intronic
919027710 1:192199437-192199459 TGACCCACACTCAGATGGGGAGG + Intergenic
919737573 1:200962711-200962733 TGGGCCACACTGTGCTGTGGAGG + Intergenic
919743134 1:200992437-200992459 TGGCCCACACTCTCCAGGGAGGG + Intronic
922747184 1:228050961-228050983 GGGCACACACCCTGCTGAGGAGG - Intronic
923917831 1:238529397-238529419 TGGCTCACCCTTGGCTGGTGTGG - Intergenic
1063864494 10:10349616-10349638 TGGCCCACACTCTGGTTGTGAGG - Intergenic
1064294246 10:14064125-14064147 TAGCTCCCACCCAGCTGGGGAGG - Intronic
1066678824 10:37916499-37916521 AGGATCACGCTCTGCTGGGGAGG + Intergenic
1068296619 10:55079869-55079891 TTGCTCAGGCTCTGGTGGGGAGG + Intronic
1069744685 10:70707526-70707548 TAGAATACACTCTGCTGGGGCGG - Intronic
1070877336 10:79826207-79826229 TGGCCCAGACGCGGCTGGGGCGG + Intergenic
1070992627 10:80745910-80745932 TGGCTTACAATTTGGTGGGGTGG - Intergenic
1071643833 10:87342251-87342273 TGGCCCAGACGCGGCTGGGGCGG + Intergenic
1071771048 10:88728958-88728980 TGTCCCACATCCTGCTGGGGAGG + Intronic
1073767148 10:106695177-106695199 TGGCTCACAGTCTTGTCGGGTGG - Intronic
1074091385 10:110261448-110261470 TGCCTCACACTCTCTTGGAGGGG - Intronic
1074744901 10:116522873-116522895 GGGCTCCCACTCTCCTGGGGAGG + Intergenic
1075004272 10:118819077-118819099 TTGGGCACACTTTGCTGGGGAGG + Intergenic
1075336984 10:121615761-121615783 AGGCTCTCACCCTGGTGGGGAGG + Intergenic
1075386531 10:122059355-122059377 TGGCTCAGACTCTTCAAGGGGGG - Intronic
1076447663 10:130528828-130528850 TGTCTCCCACTCTGTTGGTGAGG + Intergenic
1076595298 10:131621182-131621204 GGGCACACACTGTGCTGGGAGGG + Intergenic
1076674454 10:132140917-132140939 TGGTTCAGACCCTCCTGGGGAGG - Intronic
1076736573 10:132461784-132461806 TGGACCCCACCCTGCTGGGGCGG - Intergenic
1077611037 11:3643100-3643122 TGGCTGACACTCTGAGGGGATGG - Intergenic
1078264113 11:9740413-9740435 TGACTAACACTCTGGTGGAGAGG + Intronic
1078369086 11:10730251-10730273 AGGGTGACACTCTGCTGGGCTGG + Intergenic
1078991237 11:16648346-16648368 GGGCTCAGACTCTCCTTGGGTGG - Intronic
1079098188 11:17524459-17524481 TGGCTCCCTGTCTGCTGAGGTGG - Exonic
1079464180 11:20713306-20713328 GGGCTCAGACTCTTCTTGGGTGG + Intronic
1079523985 11:21362823-21362845 TGGCTCAGACTCTCCTTGGGTGG + Intronic
1080880397 11:36314394-36314416 TGGCTCACAATAAGCTGGTGAGG + Intronic
1081997893 11:47376747-47376769 TGGGCCACACGCTGCGGGGGCGG - Intronic
1082990670 11:59205050-59205072 TGGCTCCCACTGTGGTTGGGAGG - Exonic
1084008159 11:66334028-66334050 TTGCTCCAACTCTACTGGGGAGG + Exonic
1084097000 11:66918039-66918061 GGGCTCACAGGCTGCTGTGGGGG - Intronic
1084118543 11:67055949-67055971 AGCCTCACCCTCTGCGGGGGCGG + Intergenic
1084330262 11:68425907-68425929 TGCCCCACACTCAGCTTGGGAGG - Intronic
1084680644 11:70664300-70664322 TGGCTCACTCACGGCTGGGGAGG + Intronic
1085026042 11:73237167-73237189 TAGCTCACACTATTCTGGGCAGG - Intergenic
1086825420 11:91489835-91489857 GAGCTCACACTCTTCTTGGGCGG + Intergenic
1087048342 11:93863186-93863208 TGGCCACCACTCTGCTGTGGAGG + Intergenic
1088239530 11:107759036-107759058 GAGCTCACACTCTCCTTGGGTGG - Intergenic
1088413784 11:109567234-109567256 GAGCTCACACTCTCCTTGGGTGG + Intergenic
1088881296 11:113975422-113975444 TGGCTGACCATCTGCTGAGGTGG + Intronic
1089362700 11:117901598-117901620 TTGGTCACAAGCTGCTGGGGCGG - Intronic
1090604061 11:128403220-128403242 TAGCTCACACTCGGGGGGGGGGG - Intergenic
1090852000 11:130578927-130578949 TGGCTCACACTTTCCTAGGAAGG + Intergenic
1091916221 12:4273132-4273154 CTGCACACACTCTGCAGGGGGGG + Intergenic
1092687762 12:11070720-11070742 TAGTTCAGGCTCTGCTGGGGTGG - Intronic
1093335189 12:17896607-17896629 TGGGTAACACTCTGCAGTGGAGG + Intergenic
1094525315 12:31227247-31227269 TGGCTGACAGTCTCTTGGGGAGG + Intergenic
1095118487 12:38385024-38385046 GAGCTCACACTCTCCTTGGGTGG + Intergenic
1095947664 12:47763020-47763042 TGCCAGACACTGTGCTGGGGAGG - Intronic
1096036919 12:48480588-48480610 TGGCTTATACACTGCTGGTGGGG + Intergenic
1096494940 12:52034347-52034369 TGGCTCCTAGTCTGATGGGGAGG - Intronic
1096623447 12:52878956-52878978 AAGCTCACCGTCTGCTGGGGAGG + Intergenic
1097676217 12:62604448-62604470 GGGCTCAGATTCTGCTGGTGTGG + Intergenic
1099862137 12:88234106-88234128 TGGCCACCACTCTGCTGTGGAGG - Intergenic
1100813118 12:98360024-98360046 GGGCTCCCACCCTGCTGCGGAGG + Intergenic
1101857639 12:108457136-108457158 TGGTTCAGACTCAACTGGGGCGG - Intergenic
1104643647 12:130482694-130482716 GAGCTCACATTCTGCAGGGGAGG + Intronic
1105549870 13:21383423-21383445 TGACTCACACACGGCTGAGGAGG - Intronic
1109808174 13:67471181-67471203 TGGCTGCCTCTCTGCTGGAGTGG + Intergenic
1110035176 13:70673371-70673393 TGGCTCACACTCTCCAGTGCTGG + Intergenic
1110280689 13:73690405-73690427 TTGTTCACACTCTGTTGAGGAGG + Exonic
1113019785 13:105871990-105872012 TGTCTCTCACTCTGCTGGCTAGG + Intergenic
1113329954 13:109317955-109317977 AAGCTCAGACTCTCCTGGGGTGG - Intergenic
1113728362 13:112622544-112622566 TGCCAGACCCTCTGCTGGGGTGG + Intergenic
1113881810 13:113631063-113631085 TGGCTGTCACCCTGCTGGGCTGG + Intronic
1114996213 14:28355448-28355470 TGACCCACACTTTTCTGGGGTGG - Intergenic
1115457748 14:33624176-33624198 TGTCTTACACTCTCCTGGGATGG + Intronic
1116114377 14:40629306-40629328 TGGCTCAGACTCACCTTGGGCGG + Intergenic
1118636630 14:67753943-67753965 TGGCTCATATTCTAGTGGGGAGG + Intronic
1119400931 14:74361839-74361861 GAGCTTACATTCTGCTGGGGAGG - Intergenic
1119665073 14:76479645-76479667 CTGCCTACACTCTGCTGGGGAGG + Intronic
1120736344 14:88057446-88057468 GAGCTCAGACTCTGCTGGTGTGG + Intergenic
1120887119 14:89460508-89460530 TTCCTCTCACTCTGCCGGGGAGG + Intronic
1121253390 14:92515070-92515092 TGGCTCTCACTCAGCTGGGAGGG + Intronic
1122805003 14:104252151-104252173 ATGCTCCCACTCTGTTGGGGGGG + Intergenic
1124616434 15:31245593-31245615 TGGCCCATGCCCTGCTGGGGTGG + Intergenic
1125537664 15:40451683-40451705 TGGGTCTCCCTCTGCTGTGGGGG + Intronic
1126382117 15:48059749-48059771 AAGCTCACACTCTGATGGGCAGG - Intergenic
1129468753 15:75738658-75738680 TGGCTGGCACTGGGCTGGGGCGG - Intergenic
1129591215 15:76916561-76916583 TGGCTCACACTTGGCAGGTGTGG + Intergenic
1129597267 15:76974680-76974702 GGGCTGACCCTCTGATGGGGTGG + Intergenic
1129769390 15:78193766-78193788 TGGCGCCCTCTCTGCAGGGGAGG - Intronic
1130830297 15:87592139-87592161 TGTCTAGCACTGTGCTGGGGAGG - Intergenic
1132240882 15:100256319-100256341 GGGCTAACACTCTGCTGTCGCGG + Intronic
1132359157 15:101198110-101198132 TCACTCACACTCTGCTTGGGGGG - Intronic
1132523099 16:400470-400492 TGGCTCAAACTCCTCTGGGCTGG - Exonic
1132889027 16:2195348-2195370 TGGCTTACAGTCTGTGGGGGTGG + Intronic
1133448547 16:5884247-5884269 TGGACAACACTCTGCTGGGGAGG - Intergenic
1133654748 16:7850043-7850065 TATCTCACACTCTGCTGTGCTGG - Intergenic
1133978407 16:10616814-10616836 TTGGCCACACTCTCCTGGGGGGG + Intergenic
1135037259 16:19088598-19088620 TGCTTCCCATTCTGCTGGGGCGG + Intergenic
1137619225 16:49865584-49865606 TGGCTGAGACTCTGCTGAGGGGG + Intergenic
1137764601 16:50968171-50968193 TGGCTCAGACACAGCTGGAGTGG - Intergenic
1139745289 16:69069219-69069241 GAGCTCACACCCTGTTGGGGAGG - Intronic
1140119445 16:72070943-72070965 TGGCTTACAGTTTGGTGGGGTGG - Intronic
1141159129 16:81617470-81617492 TGGCTCACACACTGTTGAGGAGG + Intronic
1141937336 16:87249648-87249670 ATGCTCACACACTGCTGGTGGGG + Intronic
1142054125 16:87981625-87981647 TGGCTCACACTCTTCTGTAGCGG - Intronic
1143057567 17:4173711-4173733 GGGCTCCCACTCAGATGGGGAGG + Intronic
1144249927 17:13406091-13406113 TGGCTTGGTCTCTGCTGGGGAGG - Intergenic
1144955361 17:19016452-19016474 TGGCTCACACTCTGCTGCTCGGG + Intronic
1146172168 17:30642652-30642674 TGGCTCTGACTCTGCTGTTGAGG + Intergenic
1147686077 17:42287692-42287714 TGGATCACAGTCGGCTGGTGAGG + Intronic
1147740883 17:42670356-42670378 AGGCTCACGCTCTGCTGCTGCGG - Exonic
1148090385 17:45019579-45019601 AGGCTCACACTCCGCGGTGGAGG - Intergenic
1148147543 17:45375540-45375562 GAGCTCACACTCTAATGGGGGGG - Intergenic
1148677222 17:49452396-49452418 TGGCTCAGCCTTTCCTGGGGTGG + Intronic
1149582598 17:57761798-57761820 TAGCTCCCACTCTGCTCGGTGGG - Intergenic
1150945670 17:69743170-69743192 GAGCTCACACTCTCCTTGGGTGG + Intergenic
1151093764 17:71472331-71472353 GAGCTCACAGTGTGCTGGGGTGG - Intergenic
1151265332 17:72950956-72950978 TGGCTCATTCTCTGTTGTGGGGG - Intronic
1152301531 17:79497812-79497834 TGGCTTAGTCCCTGCTGGGGTGG - Intronic
1155227052 18:23737968-23737990 TGGGTCACGCTGAGCTGGGGTGG + Intronic
1156498733 18:37543482-37543504 AGGCTCACACACTCATGGGGAGG - Intronic
1156826083 18:41431635-41431657 TGGTTTACAATCTGCTGGGGAGG - Intergenic
1158425050 18:57331817-57331839 TAGCTCTCACTCTCTTGGGGTGG - Intergenic
1158712633 18:59850879-59850901 TGTCTGAAACTCTTCTGGGGTGG + Intergenic
1160051895 18:75441485-75441507 TGGCTCACTCTCAGCCGGAGGGG + Intergenic
1160808536 19:1003050-1003072 CGGATCACCCGCTGCTGGGGTGG + Intronic
1161453519 19:4359402-4359424 TGGCCTGCACCCTGCTGGGGTGG - Intronic
1161740873 19:6020521-6020543 TGGCTCCCAGCCTGCTGGTGAGG - Intronic
1161856713 19:6769922-6769944 CTGCTTACACTCTACTGGGGTGG + Intergenic
1161990015 19:7679195-7679217 AGGTTCACACTAGGCTGGGGGGG - Exonic
1162002143 19:7751928-7751950 TGGCTCACACAATACTGTGGAGG - Intergenic
1162990256 19:14297386-14297408 TGGCTCTGACTCTGCTGTTGAGG - Intergenic
1163435610 19:17293441-17293463 TGGATCATTCTTTGCTGGGGGGG + Intronic
1163545255 19:17937610-17937632 TGGCTCATTCTTTGCTGTGGGGG - Intronic
1163665895 19:18604030-18604052 TGCCTCCCACTCTGTTGGGGGGG - Intronic
1165819240 19:38664083-38664105 CGGCTCCCAGTCTGCTGGCGAGG + Intronic
1166415803 19:42594285-42594307 GAGCTCACACTCTCCTGGGGAGG - Intronic
1166423307 19:42654726-42654748 GAGCTCACACTCTCCTGGGGAGG + Intronic
1166452903 19:42916948-42916970 GAGCTCACACTCTCATGGGGAGG - Intronic
1168169640 19:54576833-54576855 TGGCTCAGCCTCTCCTTGGGAGG + Intronic
927509436 2:23635266-23635288 GGGCTGACACTCACCTGGGGAGG - Intronic
929008241 2:37416099-37416121 TGCCTCACTCTCTTCTGGAGAGG - Intergenic
930312942 2:49764643-49764665 TGGCTGGCTCTCTGCTGGGATGG - Intergenic
935252994 2:101281911-101281933 TGGCTCAGATTCAGCAGGGGAGG + Exonic
935897729 2:107755678-107755700 TGGCTCTCTGTCTGCTGAGGGGG + Intergenic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
937066946 2:119024508-119024530 GGGCTCACACTCTGCTCTCGTGG + Intergenic
938018342 2:127885819-127885841 TGGCCCAGACGCGGCTGGGGCGG + Exonic
938599425 2:132821867-132821889 GGGCTCAGACTCTCCTTGGGTGG - Intronic
941651164 2:168094089-168094111 TGGCGCACAGCATGCTGGGGAGG - Intronic
943700127 2:190980336-190980358 TGGCTAAAACACTGCTGGGCAGG + Intronic
947870537 2:233435198-233435220 TGTCTCACACTCTGCAGCCGGGG + Intronic
1168833263 20:859090-859112 TGGCCCATGCTCTGCTGTGGGGG - Intergenic
1171255770 20:23688216-23688238 TGGCTGAGTCCCTGCTGGGGTGG - Intronic
1172170117 20:32925116-32925138 TGCCTCACAGTCTTCTGGGATGG - Intronic
1172820458 20:37728712-37728734 TGGCTTACTCTCTGTTGGAGAGG + Intronic
1173873610 20:46356673-46356695 AGGTCCACACTCTGCTGGGGTGG + Intronic
1174388455 20:50200991-50201013 TGGCTGACCCTCTTGTGGGGTGG + Intergenic
1174917466 20:54668663-54668685 TGGCTCATTCTCTGCGGCGGGGG + Intergenic
1175541276 20:59749507-59749529 TGGCTCTCACCCTGCTGCCGTGG + Intronic
1176430121 21:6570166-6570188 TAGCTCCCAGGCTGCTGGGGAGG + Intergenic
1177450394 21:21258539-21258561 TGACTGCCAATCTGCTGGGGAGG + Intronic
1179705515 21:43177628-43177650 TAGCTCCCAGGCTGCTGGGGAGG + Intergenic
1180108649 21:45637328-45637350 TGGCACTCACTCTGCTGGTATGG - Intergenic
1180165333 21:46022820-46022842 AGGCTCCCACTCAGCTGGGAGGG - Intergenic
1180934120 22:19613038-19613060 AGGCTCACACACTGCAGGTGAGG - Intergenic
1182425780 22:30271306-30271328 TGGCCCCCAATCTGCTGGGTGGG + Intergenic
1183282131 22:36937639-36937661 TGGCTCCCACCCTCCTGTGGGGG - Exonic
1183487436 22:38097165-38097187 CGGTTCACACTCTCCTGGGGGGG + Exonic
1183862857 22:40682076-40682098 GGGCTCACACGTTGCTGGGGAGG + Exonic
1184721868 22:46319357-46319379 TGGCCCTCACTGTGTTGGGGAGG + Intronic
950046597 3:9952011-9952033 GGGCTCCCACTCTGCTGGAGAGG + Intronic
950302948 3:11897889-11897911 AGGTGCACACTCTGGTGGGGAGG - Intergenic
950557531 3:13704521-13704543 TGGTCCACAATTTGCTGGGGTGG + Intergenic
951183801 3:19688803-19688825 GAGCTCACACTCTCCTTGGGTGG - Intergenic
951662015 3:25077366-25077388 TGACTCACAGTCTGTAGGGGAGG - Intergenic
951817033 3:26765584-26765606 TTGCTCAAACCCTTCTGGGGAGG - Intergenic
952800681 3:37288043-37288065 TGACTCACCCTTTCCTGGGGTGG - Intronic
953369145 3:42372608-42372630 TTCCTCACCCTTTGCTGGGGGGG - Intergenic
953721726 3:45362047-45362069 TGTCTCACACCTTGCTGTGGAGG + Intergenic
954502200 3:51029335-51029357 TTGCTCACCCTCTGCGGGGCTGG + Intronic
954846939 3:53567547-53567569 AGGCTCACCCTCTGGTGAGGTGG - Intronic
955398150 3:58572272-58572294 GAACCCACACTCTGCTGGGGAGG + Intronic
955445655 3:59007189-59007211 GAGCTCAGACTCTCCTGGGGCGG - Intronic
960141167 3:114152964-114152986 TGGCTCAGGGTCTGCAGGGGCGG - Intronic
961167274 3:124772116-124772138 TGGCTGACTCTGTGCTGGGATGG + Intronic
961500034 3:127325863-127325885 TAGCTCACTCTCTGGTGGGCAGG + Intergenic
962268816 3:133963113-133963135 TGACTCACATGCTGGTGGGGTGG - Intronic
962425407 3:135265103-135265125 GGGCTCACACACTGCTGGAGAGG + Intergenic
962644251 3:137420310-137420332 GGGATCACACTCTGCTTGTGAGG - Intergenic
962862194 3:139414553-139414575 GGGCTCAGACTCTTCTTGGGTGG + Intergenic
966020412 3:175202761-175202783 GAGCTCAGACTCTGCTTGGGTGG + Intronic
968866896 4:3218833-3218855 TGGCTCACACCCTGCCAGGTCGG - Intronic
969674047 4:8605175-8605197 TGGGCCACACACAGCTGGGGAGG + Intronic
970222902 4:13828540-13828562 TGTGTCACACTCTGCTCAGGAGG - Intergenic
970549310 4:17163562-17163584 GAGCTCACACTCTCCTTGGGTGG + Intergenic
972387862 4:38585285-38585307 TGGATTACACTCAGCTGGTGGGG - Intergenic
972632596 4:40855235-40855257 GAGCTCACACTATGCTGGCGTGG - Intronic
973805041 4:54517608-54517630 TTGATAACACTCAGCTGGGGTGG + Intergenic
976791284 4:88880983-88881005 AGGCTCAGACTCTTCTTGGGCGG - Intronic
977762760 4:100759198-100759220 GGGTTCAAACTCTCCTGGGGTGG - Intronic
979365153 4:119813451-119813473 TGGCTCACTCTTTGCTGAGCTGG + Intergenic
979434614 4:120673732-120673754 GGGCTCAGACTCTTCTTGGGTGG - Intergenic
981545336 4:145887595-145887617 AGGCTTTCCCTCTGCTGGGGTGG + Intronic
982264845 4:153528800-153528822 TGGCCCACACTCTCCGAGGGAGG - Intronic
984549080 4:181139364-181139386 TGGTTCCTACTGTGCTGGGGAGG + Intergenic
985102676 4:186474096-186474118 TGCCGTACACTTTGCTGGGGCGG + Intronic
985618070 5:936565-936587 TGGCTCTCTCCGTGCTGGGGTGG - Intergenic
986404384 5:7411288-7411310 TGGCTCACCCTCTGAGGTGGGGG + Intronic
986985253 5:13493814-13493836 TGGGTAACACTGTGCTGGTGGGG + Intergenic
989161507 5:38395707-38395729 TGGCTCACAGTCCAGTGGGGAGG - Intronic
989512044 5:42299519-42299541 TGGCTCACTCTCTGCTATGTGGG - Intergenic
993776366 5:92003022-92003044 GGGCTCACCCTCTGCTGCAGAGG - Intergenic
994171525 5:96663040-96663062 GGGCTCACACTCCGCTTGGCCGG - Intronic
996326993 5:122286454-122286476 TAGCTCAGACTCTCCTTGGGTGG + Intergenic
997387867 5:133487868-133487890 TGGCTCTAACTCTGCTGCTGAGG + Intronic
1001212964 5:169827909-169827931 AGGCACACACTCTGTTGGCGGGG + Intronic
1001569298 5:172719655-172719677 TGGCTCACAGTTGGCTTGGGTGG + Intergenic
1001928648 5:175657726-175657748 GGGCTCACAATCTGCGGGGCGGG + Intergenic
1003061960 6:2870521-2870543 TGGCTCACACAGTGCAGCGGCGG + Intergenic
1003113516 6:3267838-3267860 TGGCCCACACACTGCTGAGAAGG - Intronic
1003242180 6:4354326-4354348 TGGGTTACACTCTGGTGGAGAGG - Intergenic
1003637640 6:7847654-7847676 AGTCACACACTCAGCTGGGGTGG + Intronic
1005292763 6:24395650-24395672 TGTTTCTGACTCTGCTGGGGTGG + Intergenic
1005419898 6:25638152-25638174 TGGCCCAGACTCAGCAGGGGAGG - Intergenic
1006037186 6:31222988-31223010 TGGATCAGGCTCTGCTGGAGGGG + Intergenic
1007126627 6:39431315-39431337 TGGCTGACAACCTGCTGAGGAGG + Intronic
1007932475 6:45704759-45704781 TAGCTTACACTCTGAAGGGGTGG + Intergenic
1011588955 6:88952268-88952290 GGGCTCAGACTCTCCTTGGGTGG - Intronic
1013618168 6:111864123-111864145 TGTTTGTCACTCTGCTGGGGTGG + Intronic
1014308084 6:119766898-119766920 TGGCTTACAATTTGGTGGGGTGG + Intergenic
1014603905 6:123448583-123448605 GGGCTCAGACTCTCCTTGGGTGG - Intronic
1014937984 6:127406340-127406362 TGGTTCATACTCTGTTAGGGTGG - Intergenic
1018653132 6:166007818-166007840 TGGCTCCTTCTTTGCTGGGGTGG - Intergenic
1018900760 6:168050652-168050674 GGGCTCACACTGTGCTGAGGAGG - Intergenic
1019598433 7:1869187-1869209 AGGCACACACGCTGCTGTGGGGG + Intronic
1019713485 7:2527899-2527921 TGACTCACCCTGTCCTGGGGAGG - Exonic
1019861058 7:3658426-3658448 GGGCTCACATTCTGCTGAGTGGG + Intronic
1020743782 7:12055490-12055512 TGGCTCTGACTCTGATGGGAGGG - Intergenic
1022381739 7:29866781-29866803 TGGCTCTCACACTGCTTGTGAGG + Intronic
1026118532 7:67516808-67516830 TGGTTCACACTCTTCTGACGGGG - Intergenic
1026980889 7:74526080-74526102 TGGCTCACACCTGCCTGGGGCGG - Intronic
1031462216 7:122065198-122065220 AGGCTGACATTCTGCTGGTGCGG - Intergenic
1032176729 7:129635634-129635656 GGGTTCAGACTCTCCTGGGGTGG + Intronic
1032266708 7:130374686-130374708 TGGCTCCCACGCTGCTGGGGTGG + Intergenic
1032384523 7:131512281-131512303 AAGCTAACACTCTGGTGGGGAGG + Intronic
1032722199 7:134559431-134559453 TGGCTTACAATTTGGTGGGGTGG - Intronic
1033333689 7:140435191-140435213 TGGCTCAAACTCCTCTGGGCTGG + Intergenic
1034032904 7:147787235-147787257 TGCATCCCACTCAGCTGGGGTGG + Intronic
1034733745 7:153410812-153410834 TGCCTGACACCCTGCTGGCGGGG + Intergenic
1035301926 7:157902899-157902921 AGGCTCACAATCAGCTTGGGAGG - Intronic
1037182632 8:16025827-16025849 TGTCTCAGACTCTGCTGTGGGGG - Intergenic
1037656254 8:20886813-20886835 TGGCTCACTCTCTTCAGGGCTGG - Intergenic
1037752911 8:21694306-21694328 GGGCACTTACTCTGCTGGGGTGG - Intronic
1037922466 8:22817049-22817071 TGGCTCACCCTCTTCAGGGAGGG - Intronic
1039484994 8:37903469-37903491 TGTTTCATACTCAGCTGGGGAGG - Intergenic
1040447948 8:47515098-47515120 TGGGCCACACTGTGCTGTGGAGG + Intronic
1040913337 8:52543310-52543332 TGGCTCAGACTCTCCTAGAGGGG - Intronic
1041927069 8:63248228-63248250 TCGCTCAGACTCTCCTTGGGTGG + Intergenic
1042558389 8:70053134-70053156 TGGGTCACACTCTCTTGGGTGGG - Intronic
1043352561 8:79377687-79377709 GGGCTCCCACTCTGCATGGGCGG - Intergenic
1043616363 8:82130271-82130293 TGGCACAGACTCTCCTTGGGTGG - Intergenic
1047842382 8:128767053-128767075 GGGCTCAGACTCTCCTTGGGTGG - Intergenic
1048273451 8:133047673-133047695 CAGCCCACACGCTGCTGGGGAGG - Intronic
1049178495 8:141208311-141208333 CGGCTCTCCCACTGCTGGGGCGG - Intronic
1049339344 8:142103680-142103702 GGGCTCAGACTCAGCTGGGTGGG - Intergenic
1052996378 9:34553592-34553614 TGGTTATCACCCTGCTGGGGCGG + Intronic
1056622930 9:88229183-88229205 TGGCTCACAGTCTGCTTGGGAGG + Intergenic
1057311606 9:93946557-93946579 TGCCAGACACTGTGCTGGGGAGG - Intergenic
1058746321 9:107994665-107994687 GGGTTCACCCTTTGCTGGGGAGG - Intergenic
1060997529 9:127883542-127883564 TGGCTCACACTCCTGAGGGGAGG + Intergenic
1061613302 9:131762762-131762784 CGCCTCACACCCTGCTGTGGTGG + Intergenic
1062208677 9:135351469-135351491 TGGCTCACAGTCGGTGGGGGTGG - Intergenic
1062308073 9:135920744-135920766 TGGCTAACCCACCGCTGGGGAGG + Intergenic
1062383578 9:136299271-136299293 TGGCTCACACTCCACATGGGAGG + Intronic
1062713581 9:137990303-137990325 GAGCTCAGACTCTGCTTGGGCGG - Intronic
1187242719 X:17528235-17528257 TGGATCATTCTCTGCTGTGGGGG - Intronic
1187871078 X:23766050-23766072 TGGCTCACCCTCGGCAGGCGTGG - Intronic
1190895475 X:54614067-54614089 GAGCTCACACTCTCCTTGGGTGG + Intergenic
1192681615 X:73259078-73259100 TGGCTTACAATTTGGTGGGGTGG + Intergenic
1198031917 X:132761420-132761442 TGGCTCGCCCCCTGCTGGGGTGG - Intronic