ID: 902711742

View in Genome Browser
Species Human (GRCh38)
Location 1:18244629-18244651
Sequence CACCAGGCCTGAGACACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 416}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902711742_902711747 8 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711747 1:18244660-18244682 TGCCACAGAGGCCCCTGCCCTGG 0: 1
1: 0
2: 2
3: 47
4: 462
902711742_902711749 11 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711749 1:18244663-18244685 CACAGAGGCCCCTGCCCTGGTGG 0: 1
1: 0
2: 8
3: 70
4: 465
902711742_902711751 19 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711751 1:18244671-18244693 CCCCTGCCCTGGTGGAATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 128
902711742_902711756 26 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711756 1:18244678-18244700 CCTGGTGGAATAAAGGAAACTGG 0: 1
1: 0
2: 3
3: 15
4: 183
902711742_902711746 -4 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711746 1:18244648-18244670 GGTGCTGGATGCTGCCACAGAGG 0: 1
1: 0
2: 1
3: 21
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902711742 Original CRISPR CACCAGGCCTGAGACACAGA GGG (reversed) Intronic