ID: 902711745

View in Genome Browser
Species Human (GRCh38)
Location 1:18244645-18244667
Sequence CTGTGGCAGCATCCAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902711745_902711747 -8 Left 902711745 1:18244645-18244667 CCTGGTGCTGGATGCTGCCACAG 0: 1
1: 0
2: 2
3: 31
4: 300
Right 902711747 1:18244660-18244682 TGCCACAGAGGCCCCTGCCCTGG 0: 1
1: 0
2: 2
3: 47
4: 462
902711745_902711749 -5 Left 902711745 1:18244645-18244667 CCTGGTGCTGGATGCTGCCACAG 0: 1
1: 0
2: 2
3: 31
4: 300
Right 902711749 1:18244663-18244685 CACAGAGGCCCCTGCCCTGGTGG 0: 1
1: 0
2: 8
3: 70
4: 465
902711745_902711751 3 Left 902711745 1:18244645-18244667 CCTGGTGCTGGATGCTGCCACAG 0: 1
1: 0
2: 2
3: 31
4: 300
Right 902711751 1:18244671-18244693 CCCCTGCCCTGGTGGAATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 128
902711745_902711756 10 Left 902711745 1:18244645-18244667 CCTGGTGCTGGATGCTGCCACAG 0: 1
1: 0
2: 2
3: 31
4: 300
Right 902711756 1:18244678-18244700 CCTGGTGGAATAAAGGAAACTGG 0: 1
1: 0
2: 3
3: 15
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902711745 Original CRISPR CTGTGGCAGCATCCAGCACC AGG (reversed) Intronic