ID: 902711746

View in Genome Browser
Species Human (GRCh38)
Location 1:18244648-18244670
Sequence GGTGCTGGATGCTGCCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902711743_902711746 -5 Left 902711743 1:18244630-18244652 CCTCTGTGTCTCAGGCCTGGTGC 0: 1
1: 0
2: 1
3: 45
4: 382
Right 902711746 1:18244648-18244670 GGTGCTGGATGCTGCCACAGAGG 0: 1
1: 0
2: 1
3: 21
4: 281
902711742_902711746 -4 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711746 1:18244648-18244670 GGTGCTGGATGCTGCCACAGAGG 0: 1
1: 0
2: 1
3: 21
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902711746 Original CRISPR GGTGCTGGATGCTGCCACAG AGG Intronic