ID: 902711751

View in Genome Browser
Species Human (GRCh38)
Location 1:18244671-18244693
Sequence CCCCTGCCCTGGTGGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902711743_902711751 18 Left 902711743 1:18244630-18244652 CCTCTGTGTCTCAGGCCTGGTGC 0: 1
1: 0
2: 1
3: 45
4: 382
Right 902711751 1:18244671-18244693 CCCCTGCCCTGGTGGAATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 128
902711742_902711751 19 Left 902711742 1:18244629-18244651 CCCTCTGTGTCTCAGGCCTGGTG 0: 1
1: 0
2: 4
3: 33
4: 416
Right 902711751 1:18244671-18244693 CCCCTGCCCTGGTGGAATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 128
902711745_902711751 3 Left 902711745 1:18244645-18244667 CCTGGTGCTGGATGCTGCCACAG 0: 1
1: 0
2: 2
3: 31
4: 300
Right 902711751 1:18244671-18244693 CCCCTGCCCTGGTGGAATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902711751 Original CRISPR CCCCTGCCCTGGTGGAATAA AGG Intronic